Incidental Mutation 'R6568:Ccr5'
ID 526165
Institutional Source Beutler Lab
Gene Symbol Ccr5
Ensembl Gene ENSMUSG00000079227
Gene Name C-C motif chemokine receptor 5
Synonyms CD195, Cmkbr5
MMRRC Submission 044692-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R6568 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 123921557-123934153 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123925236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 280 (A280T)
Ref Sequence ENSEMBL: ENSMUSP00000107069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111442] [ENSMUST00000168179] [ENSMUST00000171499]
AlphaFold P51682
Predicted Effect probably benign
Transcript: ENSMUST00000097855
Predicted Effect probably damaging
Transcript: ENSMUST00000111442
AA Change: A280T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107069
Gene: ENSMUSG00000079227
AA Change: A280T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 314 3.8e-6 PFAM
Pfam:7tm_1 49 299 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169553
Predicted Effect probably benign
Transcript: ENSMUST00000171499
SMART Domains Protein: ENSMUSP00000127328
Gene: ENSMUSG00000079227

DomainStartEndE-ValueType
Pfam:7tm_1 49 123 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171579
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice that are homozygous for null alleles have leukocytes with defective migration and adhesion, are more susceptibility to fungal & bacterial infections, have increased length of allograft survival, and have decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T C 1: 138,779,872 (GRCm39) K127E possibly damaging Het
Ash1l G A 3: 88,959,344 (GRCm39) M2240I probably benign Het
Bhmt1b A T 18: 87,775,566 (GRCm39) Y363F probably benign Het
Ceacam5 C T 7: 17,479,416 (GRCm39) L178F probably damaging Het
Col2a1 T C 15: 97,875,157 (GRCm39) N1259S unknown Het
Doc2b A C 11: 75,667,820 (GRCm39) probably null Het
Fryl T C 5: 73,216,859 (GRCm39) N2144D probably damaging Het
Hdac1-ps A G 17: 78,800,017 (GRCm39) Y336C probably damaging Het
Ighv1-34 A T 12: 114,815,231 (GRCm39) W5R probably benign Het
Kdr A G 5: 76,122,434 (GRCm39) V497A probably benign Het
Miip T A 4: 147,950,372 (GRCm39) M75L probably benign Het
Mplkip T C 13: 17,870,262 (GRCm39) S65P probably damaging Het
Ms4a13 A G 19: 11,168,923 (GRCm39) L34P probably damaging Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Nek1 T C 8: 61,559,855 (GRCm39) S896P probably benign Het
Or5ac17 A T 16: 59,036,641 (GRCm39) C112S probably benign Het
Polr3b T A 10: 84,470,767 (GRCm39) M136K probably damaging Het
Rgsl1 A C 1: 153,697,292 (GRCm39) W508G possibly damaging Het
Ros1 A T 10: 52,038,908 (GRCm39) M354K probably damaging Het
Slc34a2 T C 5: 53,226,476 (GRCm39) L533P probably damaging Het
Taf2 G A 15: 54,928,026 (GRCm39) L126F probably damaging Het
Tlr12 T C 4: 128,511,785 (GRCm39) D155G probably benign Het
Trpm2 C T 10: 77,773,660 (GRCm39) R585Q probably benign Het
Zfp942 T G 17: 22,148,043 (GRCm39) K195N probably benign Het
Other mutations in Ccr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ccr5 APN 9 123,924,443 (GRCm39) missense possibly damaging 0.59
IGL00551:Ccr5 APN 9 123,924,625 (GRCm39) missense probably damaging 1.00
IGL01153:Ccr5 APN 9 123,924,649 (GRCm39) missense probably damaging 1.00
R0014:Ccr5 UTSW 9 123,924,658 (GRCm39) missense probably damaging 1.00
R0014:Ccr5 UTSW 9 123,924,658 (GRCm39) missense probably damaging 1.00
R0355:Ccr5 UTSW 9 123,924,951 (GRCm39) missense possibly damaging 0.90
R1570:Ccr5 UTSW 9 123,925,000 (GRCm39) missense probably benign 0.29
R4305:Ccr5 UTSW 9 123,925,111 (GRCm39) missense possibly damaging 0.78
R4307:Ccr5 UTSW 9 123,925,111 (GRCm39) missense possibly damaging 0.78
R4570:Ccr5 UTSW 9 123,924,912 (GRCm39) nonsense probably null
R4589:Ccr5 UTSW 9 123,924,539 (GRCm39) missense probably benign 0.00
R5549:Ccr5 UTSW 9 123,925,408 (GRCm39) missense probably benign 0.09
R5566:Ccr5 UTSW 9 123,924,697 (GRCm39) missense probably benign 0.07
R5871:Ccr5 UTSW 9 123,924,558 (GRCm39) missense probably benign 0.02
R7258:Ccr5 UTSW 9 123,925,311 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTACTCAGGAATTCTCCAC -3'
(R):5'- CATGTTCTCCTGTGGATCGG -3'

Sequencing Primer
(F):5'- CACCCTGTTTCGCTGTAGGAATG -3'
(R):5'- TAGACTGAGCTTGCACGATC -3'
Posted On 2018-06-22