Incidental Mutation 'R6568:Gm10093'
ID526176
Institutional Source Beutler Lab
Gene Symbol Gm10093
Ensembl Gene ENSMUSG00000061062
Gene Namepredicted pseudogene 10093
SynonymsEG15181
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R6568 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78491565-78493541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78492588 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 336 (Y336C)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
Predicted Effect probably damaging
Transcript: ENSMUST00000079363
AA Change: Y336C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: Y336C

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T C 1: 138,852,134 K127E possibly damaging Het
Ash1l G A 3: 89,052,037 M2240I probably benign Het
Ccr5 G A 9: 124,125,199 A280T probably damaging Het
Ceacam5 C T 7: 17,745,491 L178F probably damaging Het
Col2a1 T C 15: 97,977,276 N1259S unknown Het
Doc2b A C 11: 75,776,994 probably null Het
Fryl T C 5: 73,059,516 N2144D probably damaging Het
Gm5096 A T 18: 87,757,442 Y363F probably benign Het
Ighv1-34 A T 12: 114,851,611 W5R probably benign Het
Kdr A G 5: 75,961,774 V497A probably benign Het
Miip T A 4: 147,865,915 M75L probably benign Het
Mplkip T C 13: 17,695,677 S65P probably damaging Het
Ms4a13 A G 19: 11,191,559 L34P probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nek1 T C 8: 61,106,821 S896P probably benign Het
Olfr199 A T 16: 59,216,278 C112S probably benign Het
Polr3b T A 10: 84,634,903 M136K probably damaging Het
Rgsl1 A C 1: 153,821,546 W508G possibly damaging Het
Ros1 A T 10: 52,162,812 M354K probably damaging Het
Slc34a2 T C 5: 53,069,134 L533P probably damaging Het
Taf2 G A 15: 55,064,630 L126F probably damaging Het
Tlr12 T C 4: 128,617,992 D155G probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Zfp942 T G 17: 21,929,062 K195N probably benign Het
Other mutations in Gm10093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Gm10093 APN 17 78492129 missense probably damaging 1.00
IGL01983:Gm10093 APN 17 78492853 missense probably benign
IGL02543:Gm10093 APN 17 78491874 missense probably damaging 0.97
R1174:Gm10093 UTSW 17 78492078 missense probably benign 0.01
R1605:Gm10093 UTSW 17 78492108 missense probably damaging 0.98
R2416:Gm10093 UTSW 17 78492516 missense probably damaging 1.00
R2919:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R2920:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R3846:Gm10093 UTSW 17 78492972 missense possibly damaging 0.91
R4544:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R4546:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R5223:Gm10093 UTSW 17 78492438 missense probably benign 0.02
R5297:Gm10093 UTSW 17 78492758 missense probably benign
R6164:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R6726:Gm10093 UTSW 17 78492858 missense probably damaging 0.99
R6901:Gm10093 UTSW 17 78492660 missense probably benign 0.07
R6923:Gm10093 UTSW 17 78492914 missense possibly damaging 0.91
R7838:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R8002:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
X0060:Gm10093 UTSW 17 78492128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCTTCAATCTGACCATCAAAGG -3'
(R):5'- AGATGCGTTTGTCAGGGTCC -3'

Sequencing Primer
(F):5'- TTCAATCTGACCATCAAAGGACACG -3'
(R):5'- GCGTTTGTCAGGGTCCTCCTC -3'
Posted On2018-06-22