Incidental Mutation 'R6569:Olfr857'
ID526193
Institutional Source Beutler Lab
Gene Symbol Olfr857
Ensembl Gene ENSMUSG00000094678
Gene Nameolfactory receptor 857
SynonymsMOR146-8P, GA_x6K02T2PVTD-13452606-13453535
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6569 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19709433-19714930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19713342 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 172 (V172I)
Ref Sequence ENSEMBL: ENSMUSP00000150889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077023] [ENSMUST00000212013] [ENSMUST00000217450]
Predicted Effect probably benign
Transcript: ENSMUST00000077023
AA Change: V172I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076281
Gene: ENSMUSG00000094678
AA Change: V172I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-5 PFAM
Pfam:7tm_1 41 290 9.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212013
AA Change: V172I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212753
AA Change: V137I
Predicted Effect probably benign
Transcript: ENSMUST00000217450
AA Change: V172I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T A 6: 85,641,339 V2789D probably benign Het
Ccdc40 A G 11: 119,242,734 T567A probably damaging Het
Col7a1 T G 9: 108,978,110 probably null Het
Crb2 A T 2: 37,792,151 Q173L probably damaging Het
Cuzd1 T C 7: 131,311,757 Y377C probably damaging Het
Echdc1 T C 10: 29,322,284 M75T probably damaging Het
Faah G T 4: 116,017,632 A9E probably benign Het
Gpatch1 T C 7: 35,291,738 D627G probably damaging Het
Grid1 G T 14: 35,323,339 V380F possibly damaging Het
Klf4 T C 4: 55,530,394 Y239C probably damaging Het
Mkx C A 18: 6,992,820 E155* probably null Het
Mmp11 G A 10: 75,927,382 probably benign Het
Mms19 T C 19: 41,964,368 K101E possibly damaging Het
Mrpl23 C A 7: 142,535,039 R44S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1037 A G 2: 86,085,505 S91P possibly damaging Het
Olfr1248 A G 2: 89,618,015 F59S possibly damaging Het
Pcdhgc5 C T 18: 37,820,195 P174L probably damaging Het
Phf20l1 A T 15: 66,629,824 D619V probably damaging Het
Plcz1 C T 6: 140,007,707 A395T possibly damaging Het
Rbm45 A G 2: 76,379,072 D410G probably damaging Het
Sh3bp1 T C 15: 78,911,696 L675P probably damaging Het
Taf6l G A 19: 8,772,710 T208I probably damaging Het
Tnpo3 A G 6: 29,571,066 I443T possibly damaging Het
Twistnb T A 12: 33,437,883 C266S probably benign Het
Vmn1r42 A G 6: 89,845,443 L48P probably damaging Het
Vmn2r25 A G 6: 123,851,982 V111A probably benign Het
Other mutations in Olfr857
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Olfr857 APN 9 19713279 missense probably benign 0.00
IGL01919:Olfr857 APN 9 19713342 missense probably benign 0.00
IGL02157:Olfr857 APN 9 19713289 missense probably benign 0.07
IGL02550:Olfr857 APN 9 19713047 missense possibly damaging 0.92
IGL03329:Olfr857 APN 9 19713301 missense probably benign 0.16
IGL02799:Olfr857 UTSW 9 19713018 missense probably damaging 0.99
R0356:Olfr857 UTSW 9 19713447 missense probably damaging 1.00
R0927:Olfr857 UTSW 9 19713649 missense probably benign 0.39
R1161:Olfr857 UTSW 9 19713180 missense probably damaging 1.00
R1848:Olfr857 UTSW 9 19713090 missense probably benign 0.01
R5191:Olfr857 UTSW 9 19713334 missense probably damaging 0.98
R5216:Olfr857 UTSW 9 19713289 missense probably benign 0.07
R5259:Olfr857 UTSW 9 19712813 intron probably null
R5342:Olfr857 UTSW 9 19713037 missense probably damaging 1.00
R5506:Olfr857 UTSW 9 19713274 missense possibly damaging 0.61
R5526:Olfr857 UTSW 9 19713698 nonsense probably null
R5594:Olfr857 UTSW 9 19713006 missense probably damaging 0.99
R5928:Olfr857 UTSW 9 19713753 missense probably benign 0.02
R6858:Olfr857 UTSW 9 19713469 missense probably damaging 0.98
R7077:Olfr857 UTSW 9 19713132 missense probably benign
R7378:Olfr857 UTSW 9 19712887 missense probably damaging 1.00
R7771:Olfr857 UTSW 9 19713471 missense probably benign
R8038:Olfr857 UTSW 9 19713680 missense possibly damaging 0.52
R8160:Olfr857 UTSW 9 19712789 intron probably benign
R8223:Olfr857 UTSW 9 19713409 missense probably benign
R8400:Olfr857 UTSW 9 19713093 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TTGCATGCCCATAACAGATCC -3'
(R):5'- TTCCCTAACAGTGATGGAACTC -3'

Sequencing Primer
(F):5'- CTTATGCTGAATGCCTAACTCAG -3'
(R):5'- ATATTCCTGAGGCAGGGA -3'
Posted On2018-06-22