Incidental Mutation 'R6569:Grid1'
ID526199
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6569 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35323339 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 380 (V380F)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043349
AA Change: V380F

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: V380F

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T A 6: 85,641,339 V2789D probably benign Het
Ccdc40 A G 11: 119,242,734 T567A probably damaging Het
Col7a1 T G 9: 108,978,110 probably null Het
Crb2 A T 2: 37,792,151 Q173L probably damaging Het
Cuzd1 T C 7: 131,311,757 Y377C probably damaging Het
Echdc1 T C 10: 29,322,284 M75T probably damaging Het
Faah G T 4: 116,017,632 A9E probably benign Het
Gpatch1 T C 7: 35,291,738 D627G probably damaging Het
Klf4 T C 4: 55,530,394 Y239C probably damaging Het
Mkx C A 18: 6,992,820 E155* probably null Het
Mmp11 G A 10: 75,927,382 probably benign Het
Mms19 T C 19: 41,964,368 K101E possibly damaging Het
Mrpl23 C A 7: 142,535,039 R44S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1037 A G 2: 86,085,505 S91P possibly damaging Het
Olfr1248 A G 2: 89,618,015 F59S possibly damaging Het
Olfr857 G A 9: 19,713,342 V172I probably benign Het
Pcdhgc5 C T 18: 37,820,195 P174L probably damaging Het
Phf20l1 A T 15: 66,629,824 D619V probably damaging Het
Plcz1 C T 6: 140,007,707 A395T possibly damaging Het
Rbm45 A G 2: 76,379,072 D410G probably damaging Het
Sh3bp1 T C 15: 78,911,696 L675P probably damaging Het
Taf6l G A 19: 8,772,710 T208I probably damaging Het
Tnpo3 A G 6: 29,571,066 I443T possibly damaging Het
Twistnb T A 12: 33,437,883 C266S probably benign Het
Vmn1r42 A G 6: 89,845,443 L48P probably damaging Het
Vmn2r25 A G 6: 123,851,982 V111A probably benign Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGACTGCAATGATAGCAGG -3'
(R):5'- CCAAGGCACTGCTTCTGTTG -3'

Sequencing Primer
(F):5'- GCAGGTAAAATTCTTGTGGATTCTTC -3'
(R):5'- GCCATCTTTAGTGGTACTGAAGCC -3'
Posted On2018-06-22