Mutagenetix > Incidental Mutation

Incidental Mutation 'R6569:Grid1'

526199

Institutional Source

Beutler Lab

Gene Symbol

Grid1

Ensembl Gene

ENSMUSG00000041078

Gene Name

glutamate receptor, ionotropic, delta 1

Synonyms

GluRdelta1

MMRRC Submission

044693-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R6569 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34542065-35305336 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 35045296 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 380 (V380F)

Ref Sequence

ENSEMBL: ENSMUSP00000044009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043349]

AlphaFold

Q61627

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043349
AA Change: V380F

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: V380F

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	36	400	4.1e-51	PFAM
PBPe	438	807	4.68e-110	SMART
Lig_chan-Glu_bd	448	510	8.18e-25	SMART
low complexity region	838	853	N/A	INTRINSIC
low complexity region	943	958	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	T	A	6: 85,618,321 (GRCm39)	V2789D	probably benign	Het
Ccdc40	A	G	11: 119,133,560 (GRCm39)	T567A	probably damaging	Het
Col7a1	T	G	9: 108,807,178 (GRCm39)		probably null	Het
Crb2	A	T	2: 37,682,163 (GRCm39)	Q173L	probably damaging	Het
Cuzd1	T	C	7: 130,913,486 (GRCm39)	Y377C	probably damaging	Het
Echdc1	T	C	10: 29,198,280 (GRCm39)	M75T	probably damaging	Het
Faah	G	T	4: 115,874,829 (GRCm39)	A9E	probably benign	Het
Gpatch1	T	C	7: 34,991,163 (GRCm39)	D627G	probably damaging	Het
Klf4	T	C	4: 55,530,394 (GRCm39)	Y239C	probably damaging	Het
Mkx	C	A	18: 6,992,820 (GRCm39)	E155*	probably null	Het
Mmp11	G	A	10: 75,763,216 (GRCm39)		probably benign	Het
Mms19	T	C	19: 41,952,807 (GRCm39)	K101E	possibly damaging	Het
Mrpl23	C	A	7: 142,088,776 (GRCm39)	R44S	probably damaging	Het
Myo1c	C	T	11: 75,562,461 (GRCm39)	P918S	probably benign	Het
Or4a75	A	G	2: 89,448,359 (GRCm39)	F59S	possibly damaging	Het
Or7e166	G	A	9: 19,624,638 (GRCm39)	V172I	probably benign	Het
Or8u10	A	G	2: 85,915,849 (GRCm39)	S91P	possibly damaging	Het
Pcdhgc5	C	T	18: 37,953,248 (GRCm39)	P174L	probably damaging	Het
Phf20l1	A	T	15: 66,501,673 (GRCm39)	D619V	probably damaging	Het
Plcz1	C	T	6: 139,953,433 (GRCm39)	A395T	possibly damaging	Het
Polr1f	T	A	12: 33,487,882 (GRCm39)	C266S	probably benign	Het
Rbm45	A	G	2: 76,209,416 (GRCm39)	D410G	probably damaging	Het
Sh3bp1	T	C	15: 78,795,896 (GRCm39)	L675P	probably damaging	Het
Taf6l	G	A	19: 8,750,074 (GRCm39)	T208I	probably damaging	Het
Tnpo3	A	G	6: 29,571,065 (GRCm39)	I443T	possibly damaging	Het
Vmn1r42	A	G	6: 89,822,425 (GRCm39)	L48P	probably damaging	Het
Vmn2r25	A	G	6: 123,828,941 (GRCm39)	V111A	probably benign	Het

Other mutations in Grid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Grid1	APN	14	35,167,844 (GRCm39)	missense	possibly damaging	0.70
IGL01016:Grid1	APN	14	34,544,596 (GRCm39)	nonsense	probably null
IGL01643:Grid1	APN	14	35,045,392 (GRCm39)	critical splice donor site	probably null
IGL01697:Grid1	APN	14	35,031,214 (GRCm39)	missense	probably benign	0.21
IGL01879:Grid1	APN	14	35,172,327 (GRCm39)	missense	possibly damaging	0.93
IGL01975:Grid1	APN	14	35,045,383 (GRCm39)	missense	probably benign
IGL02515:Grid1	APN	14	35,174,302 (GRCm39)	missense	probably damaging	0.99
IGL02935:Grid1	APN	14	34,544,515 (GRCm39)	missense	possibly damaging	0.86
IGL03279:Grid1	APN	14	34,667,722 (GRCm39)	missense	probably damaging	0.98
IGL03286:Grid1	APN	14	35,242,642 (GRCm39)	splice site	probably benign
IGL03296:Grid1	APN	14	35,302,524 (GRCm39)	missense	possibly damaging	0.52
IGL03305:Grid1	APN	14	34,973,664 (GRCm39)	missense	probably damaging	1.00
R0533:Grid1	UTSW	14	35,031,342 (GRCm39)	missense	possibly damaging	0.84
R0746:Grid1	UTSW	14	34,544,647 (GRCm39)	missense	possibly damaging	0.92
R0811:Grid1	UTSW	14	34,544,576 (GRCm39)	missense	probably benign
R0812:Grid1	UTSW	14	34,544,576 (GRCm39)	missense	probably benign
R1144:Grid1	UTSW	14	35,284,633 (GRCm39)	splice site	probably benign
R1217:Grid1	UTSW	14	34,542,186 (GRCm39)	start codon destroyed	probably null	0.53
R1485:Grid1	UTSW	14	34,544,540 (GRCm39)	missense	probably damaging	1.00
R1529:Grid1	UTSW	14	35,031,250 (GRCm39)	missense	probably benign	0.36
R1606:Grid1	UTSW	14	35,167,922 (GRCm39)	missense	probably damaging	0.96
R1691:Grid1	UTSW	14	35,174,286 (GRCm39)	missense	probably damaging	1.00
R1759:Grid1	UTSW	14	35,167,988 (GRCm39)	missense	possibly damaging	0.92
R2374:Grid1	UTSW	14	35,043,764 (GRCm39)	splice site	probably benign
R2415:Grid1	UTSW	14	35,172,326 (GRCm39)	missense	possibly damaging	0.69
R2866:Grid1	UTSW	14	35,284,516 (GRCm39)	missense	probably damaging	1.00
R3915:Grid1	UTSW	14	35,242,684 (GRCm39)	missense	probably damaging	1.00
R4044:Grid1	UTSW	14	35,172,358 (GRCm39)	splice site	probably benign
R4364:Grid1	UTSW	14	34,667,989 (GRCm39)	missense	probably benign	0.20
R4691:Grid1	UTSW	14	35,291,514 (GRCm39)	missense	probably benign
R4694:Grid1	UTSW	14	34,748,737 (GRCm39)	missense	probably damaging	1.00
R4749:Grid1	UTSW	14	35,302,644 (GRCm39)	missense	possibly damaging	0.50
R4794:Grid1	UTSW	14	34,544,579 (GRCm39)	missense	probably damaging	0.99
R4854:Grid1	UTSW	14	35,043,598 (GRCm39)	missense	probably benign
R5555:Grid1	UTSW	14	35,242,662 (GRCm39)	missense	possibly damaging	0.92
R6005:Grid1	UTSW	14	35,045,369 (GRCm39)	missense	probably damaging	1.00
R6176:Grid1	UTSW	14	35,284,504 (GRCm39)	missense	probably benign	0.00
R6911:Grid1	UTSW	14	34,542,185 (GRCm39)	start codon destroyed	probably benign	0.08
R7504:Grid1	UTSW	14	35,284,470 (GRCm39)	missense	probably damaging	1.00
R7744:Grid1	UTSW	14	35,172,036 (GRCm39)	missense	probably damaging	1.00
R7795:Grid1	UTSW	14	35,043,642 (GRCm39)	missense	probably damaging	1.00
R7883:Grid1	UTSW	14	35,172,259 (GRCm39)	splice site	probably null
R7913:Grid1	UTSW	14	35,291,654 (GRCm39)	missense	probably damaging	0.99
R8032:Grid1	UTSW	14	35,045,316 (GRCm39)	missense	probably benign	0.00
R8333:Grid1	UTSW	14	35,291,595 (GRCm39)	missense	possibly damaging	0.82
R8916:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8928:Grid1	UTSW	14	35,302,723 (GRCm39)	missense	probably benign	0.25
R8934:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8935:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8939:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8986:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8993:Grid1	UTSW	14	34,748,899 (GRCm39)	missense	probably benign	0.00
R9238:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9310:Grid1	UTSW	14	34,748,762 (GRCm39)	missense	probably damaging	1.00
R9332:Grid1	UTSW	14	35,045,360 (GRCm39)	missense	probably benign	0.06
R9335:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9336:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9478:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9479:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9496:Grid1	UTSW	14	35,291,571 (GRCm39)	missense	probably damaging	1.00
R9583:Grid1	UTSW	14	35,302,492 (GRCm39)	missense	possibly damaging	0.90
R9601:Grid1	UTSW	14	35,167,814 (GRCm39)	missense	probably damaging	0.99
R9734:Grid1	UTSW	14	35,302,742 (GRCm39)	missense	probably benign
U24488:Grid1	UTSW	14	35,302,534 (GRCm39)	missense	probably benign	0.00
Z1088:Grid1	UTSW	14	35,174,251 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCGACTGCAATGATAGCAGG -3'
(R):5'- CCAAGGCACTGCTTCTGTTG -3'

Sequencing Primer
(F):5'- GCAGGTAAAATTCTTGTGGATTCTTC -3'
(R):5'- GCCATCTTTAGTGGTACTGAAGCC -3'

Posted On

2018-06-22