Mutagenetix > Incidental Mutations

Incidental Mutation 'R6569:Phf20l1'

526200

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.252) question?

Stock #

R6569 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66629824 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 619 (D619V)

Ref Sequence

ENSEMBL: ENSMUSP00000155465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048188
AA Change: D646V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: D646V

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229033

Predicted Effect

probably damaging
Transcript: ENSMUST00000229160
AA Change: D645V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000229576

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230250

Predicted Effect

probably damaging
Transcript: ENSMUST00000230948
AA Change: D619V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231177

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	T	A	6: 85,641,339	V2789D	probably benign	Het
Ccdc40	A	G	11: 119,242,734	T567A	probably damaging	Het
Col7a1	T	G	9: 108,978,110		probably null	Het
Crb2	A	T	2: 37,792,151	Q173L	probably damaging	Het
Cuzd1	T	C	7: 131,311,757	Y377C	probably damaging	Het
Echdc1	T	C	10: 29,322,284	M75T	probably damaging	Het
Faah	G	T	4: 116,017,632	A9E	probably benign	Het
Gpatch1	T	C	7: 35,291,738	D627G	probably damaging	Het
Grid1	G	T	14: 35,323,339	V380F	possibly damaging	Het
Klf4	T	C	4: 55,530,394	Y239C	probably damaging	Het
Mkx	C	A	18: 6,992,820	E155*	probably null	Het
Mmp11	G	A	10: 75,927,382		probably benign	Het
Mms19	T	C	19: 41,964,368	K101E	possibly damaging	Het
Mrpl23	C	A	7: 142,535,039	R44S	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Olfr1037	A	G	2: 86,085,505	S91P	possibly damaging	Het
Olfr1248	A	G	2: 89,618,015	F59S	possibly damaging	Het
Olfr857	G	A	9: 19,713,342	V172I	probably benign	Het
Pcdhgc5	C	T	18: 37,820,195	P174L	probably damaging	Het
Plcz1	C	T	6: 140,007,707	A395T	possibly damaging	Het
Rbm45	A	G	2: 76,379,072	D410G	probably damaging	Het
Sh3bp1	T	C	15: 78,911,696	L675P	probably damaging	Het
Taf6l	G	A	19: 8,772,710	T208I	probably damaging	Het
Tnpo3	A	G	6: 29,571,066	I443T	possibly damaging	Het
Twistnb	T	A	12: 33,437,883	C266S	probably benign	Het
Vmn1r42	A	G	6: 89,845,443	L48P	probably damaging	Het
Vmn2r25	A	G	6: 123,851,982	V111A	probably benign	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7946:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACGATGGCTACTCAGTATTACTTTC -3'
(R):5'- AGTGATCCAGAACTGCAGGG -3'

Sequencing Primer
(F):5'- GGCTACTCAGTATTACTTTCATCAG -3'
(R):5'- CAGGGCAGAGGTTGGTTAAGTAC -3'

Posted On

2018-06-22