Mutagenetix > Incidental Mutations

Incidental Mutation 'R6569:Phf20l1'

526200

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.253) question?

Stock #

R6569 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66629824 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 619 (D619V)

Ref Sequence

ENSEMBL: ENSMUSP00000155465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048188
AA Change: D646V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: D646V

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229033

Predicted Effect

probably damaging
Transcript: ENSMUST00000229160
AA Change: D645V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000229576

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230250

Predicted Effect

probably damaging
Transcript: ENSMUST00000230948
AA Change: D619V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231177

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	T	A	6: 85,641,339	V2789D	probably benign	Het
Ccdc40	A	G	11: 119,242,734	T567A	probably damaging	Het
Col7a1	T	G	9: 108,978,110		probably null	Het
Crb2	A	T	2: 37,792,151	Q173L	probably damaging	Het
Cuzd1	T	C	7: 131,311,757	Y377C	probably damaging	Het
Echdc1	T	C	10: 29,322,284	M75T	probably damaging	Het
Faah	G	T	4: 116,017,632	A9E	probably benign	Het
Gpatch1	T	C	7: 35,291,738	D627G	probably damaging	Het
Grid1	G	T	14: 35,323,339	V380F	possibly damaging	Het
Klf4	T	C	4: 55,530,394	Y239C	probably damaging	Het
Mkx	C	A	18: 6,992,820	E155*	probably null	Het
Mmp11	G	A	10: 75,927,382		probably benign	Het
Mms19	T	C	19: 41,964,368	K101E	possibly damaging	Het
Mrpl23	C	A	7: 142,535,039	R44S	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Olfr1037	A	G	2: 86,085,505	S91P	possibly damaging	Het
Olfr1248	A	G	2: 89,618,015	F59S	possibly damaging	Het
Olfr857	G	A	9: 19,713,342	V172I	probably benign	Het
Pcdhgc5	C	T	18: 37,820,195	P174L	probably damaging	Het
Plcz1	C	T	6: 140,007,707	A395T	possibly damaging	Het
Rbm45	A	G	2: 76,379,072	D410G	probably damaging	Het
Sh3bp1	T	C	15: 78,911,696	L675P	probably damaging	Het
Taf6l	G	A	19: 8,772,710	T208I	probably damaging	Het
Tnpo3	A	G	6: 29,571,066	I443T	possibly damaging	Het
Twistnb	T	A	12: 33,437,883	C266S	probably benign	Het
Vmn1r42	A	G	6: 89,845,443	L48P	probably damaging	Het
Vmn2r25	A	G	6: 123,851,982	V111A	probably benign	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
curt	UTSW	15	66639948	missense	possibly damaging	0.90
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACGATGGCTACTCAGTATTACTTTC -3'
(R):5'- AGTGATCCAGAACTGCAGGG -3'

Sequencing Primer
(F):5'- GGCTACTCAGTATTACTTTCATCAG -3'
(R):5'- CAGGGCAGAGGTTGGTTAAGTAC -3'

Posted On

2018-06-22