Incidental Mutation 'R6569:Phf20l1'
ID526200
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene NamePHD finger protein 20-like 1
SynonymsCGI-72, E130113K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R6569 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location66577560-66647976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66629824 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 619 (D619V)
Ref Sequence ENSEMBL: ENSMUSP00000155465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]
Predicted Effect probably damaging
Transcript: ENSMUST00000048188
AA Change: D646V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: D646V

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229033
Predicted Effect probably damaging
Transcript: ENSMUST00000229160
AA Change: D645V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230250
Predicted Effect probably damaging
Transcript: ENSMUST00000230948
AA Change: D619V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231177
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T A 6: 85,641,339 V2789D probably benign Het
Ccdc40 A G 11: 119,242,734 T567A probably damaging Het
Col7a1 T G 9: 108,978,110 probably null Het
Crb2 A T 2: 37,792,151 Q173L probably damaging Het
Cuzd1 T C 7: 131,311,757 Y377C probably damaging Het
Echdc1 T C 10: 29,322,284 M75T probably damaging Het
Faah G T 4: 116,017,632 A9E probably benign Het
Gpatch1 T C 7: 35,291,738 D627G probably damaging Het
Grid1 G T 14: 35,323,339 V380F possibly damaging Het
Klf4 T C 4: 55,530,394 Y239C probably damaging Het
Mkx C A 18: 6,992,820 E155* probably null Het
Mmp11 G A 10: 75,927,382 probably benign Het
Mms19 T C 19: 41,964,368 K101E possibly damaging Het
Mrpl23 C A 7: 142,535,039 R44S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1037 A G 2: 86,085,505 S91P possibly damaging Het
Olfr1248 A G 2: 89,618,015 F59S possibly damaging Het
Olfr857 G A 9: 19,713,342 V172I probably benign Het
Pcdhgc5 C T 18: 37,820,195 P174L probably damaging Het
Plcz1 C T 6: 140,007,707 A395T possibly damaging Het
Rbm45 A G 2: 76,379,072 D410G probably damaging Het
Sh3bp1 T C 15: 78,911,696 L675P probably damaging Het
Taf6l G A 19: 8,772,710 T208I probably damaging Het
Tnpo3 A G 6: 29,571,066 I443T possibly damaging Het
Twistnb T A 12: 33,437,883 C266S probably benign Het
Vmn1r42 A G 6: 89,845,443 L48P probably damaging Het
Vmn2r25 A G 6: 123,851,982 V111A probably benign Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66629035 missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66615633 splice site probably benign
IGL00668:Phf20l1 APN 15 66632849 missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66636832 missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66641908 missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66613132 missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66597691 missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66628991 missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66640025 missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66615410 critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66641801 missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66615632 splice site probably benign
IGL02656:Phf20l1 APN 15 66629827 missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66604864 missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66594980 critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66595151 missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66594884 missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66641947 utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66597403 missense probably damaging 1.00
Abbreviated UTSW 15 66632903 critical splice donor site probably null
curt UTSW 15 66639948 missense possibly damaging 0.90
shorthand UTSW 15 66609547 missense probably damaging 1.00
PIT4305001:Phf20l1 UTSW 15 66613052 missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66609604 missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66595122 missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66615630 splice site probably benign
R1458:Phf20l1 UTSW 15 66604813 missense probably damaging 1.00
R1619:Phf20l1 UTSW 15 66615259 missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66632825 missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66594920 missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66641816 missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66604837 missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66615222 missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66597367 missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66604855 missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66636913 missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66615785 missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66636820 missense possibly damaging 0.85
R6126:Phf20l1 UTSW 15 66636824 missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66632903 critical splice donor site probably null
R6572:Phf20l1 UTSW 15 66609547 missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66630913 missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66604840 missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66604789 missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66597750 missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66636884 missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66604084 missense probably benign 0.02
R7863:Phf20l1 UTSW 15 66615235 missense possibly damaging 0.94
R7991:Phf20l1 UTSW 15 66630919 missense possibly damaging 0.64
R8015:Phf20l1 UTSW 15 66639948 missense possibly damaging 0.90
R8161:Phf20l1 UTSW 15 66604073 missense probably damaging 1.00
R8228:Phf20l1 UTSW 15 66639940 missense possibly damaging 0.81
X0065:Phf20l1 UTSW 15 66597678 missense probably damaging 0.99
X0065:Phf20l1 UTSW 15 66629806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGATGGCTACTCAGTATTACTTTC -3'
(R):5'- AGTGATCCAGAACTGCAGGG -3'

Sequencing Primer
(F):5'- GGCTACTCAGTATTACTTTCATCAG -3'
(R):5'- CAGGGCAGAGGTTGGTTAAGTAC -3'
Posted On2018-06-22