Incidental Mutation 'R6570:Zscan4d'
ID 526210
Institutional Source Beutler Lab
Gene Symbol Zscan4d
Ensembl Gene ENSMUSG00000090714
Gene Name zinc finger and SCAN domain containing 4D
Synonyms EG545913
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R6570 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 11161374-11166159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11162000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 481 (V481A)
Ref Sequence ENSEMBL: ENSMUSP00000066504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067210]
AlphaFold A7KBS4
Predicted Effect possibly damaging
Transcript: ENSMUST00000067210
AA Change: V481A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066504
Gene: ENSMUSG00000090714
AA Change: V481A

DomainStartEndE-ValueType
Pfam:SCAN 39 126 2.5e-19 PFAM
low complexity region 181 197 N/A INTRINSIC
ZnF_C2H2 395 417 5.14e-3 SMART
ZnF_C2H2 424 446 7.68e0 SMART
ZnF_C2H2 452 474 4.17e-3 SMART
ZnF_C2H2 480 503 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 T C 8: 122,857,391 V77A probably damaging Het
Cfap54 C T 10: 92,815,958 V3077I unknown Het
Erbb2 T C 11: 98,423,047 L272P possibly damaging Het
Exd1 T C 2: 119,520,173 T536A probably benign Het
Hoxc9 A T 15: 102,981,753 H34L probably benign Het
Kif19a G T 11: 114,784,905 R401L possibly damaging Het
Mad2l1bp A T 17: 46,153,007 H30Q probably benign Het
Mettl13 A G 1: 162,544,286 L26P probably damaging Het
Mmp16 G A 4: 18,011,501 V110I possibly damaging Het
Olfr165 T C 16: 19,407,318 S233G probably benign Het
Plcb4 C T 2: 135,982,986 A863V probably benign Het
Rnf168 G A 16: 32,289,210 S219N probably benign Het
Serpine3 T A 14: 62,674,321 L244Q probably damaging Het
Vmn1r75 T C 7: 11,880,956 V205A probably damaging Het
Other mutations in Zscan4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Zscan4d APN 7 11162354 missense probably benign 0.00
IGL01576:Zscan4d APN 7 11162592 missense possibly damaging 0.91
IGL01926:Zscan4d APN 7 11164994 missense probably damaging 0.98
IGL02008:Zscan4d APN 7 11162369 missense probably benign 0.00
IGL02245:Zscan4d APN 7 11162789 missense probably benign
IGL02473:Zscan4d APN 7 11162409 missense probably benign 0.04
IGL02805:Zscan4d APN 7 11164970 splice site probably benign
IGL03010:Zscan4d APN 7 11163143 missense probably damaging 0.98
IGL03383:Zscan4d APN 7 11162765 missense probably benign 0.07
R0626:Zscan4d UTSW 7 11165019 missense probably damaging 0.97
R1084:Zscan4d UTSW 7 11165005 missense probably damaging 0.99
R1457:Zscan4d UTSW 7 11164994 missense probably damaging 0.98
R2426:Zscan4d UTSW 7 11165095 missense probably damaging 0.99
R2912:Zscan4d UTSW 7 11162687 missense probably benign
R3736:Zscan4d UTSW 7 11162876 missense probably benign
R4379:Zscan4d UTSW 7 11164978 missense probably benign
R4580:Zscan4d UTSW 7 11162508 missense probably benign 0.00
R4765:Zscan4d UTSW 7 11162667 missense probably benign 0.08
R4975:Zscan4d UTSW 7 11165347 start codon destroyed probably null 0.02
R6452:Zscan4d UTSW 7 11162072 missense probably damaging 0.98
R6680:Zscan4d UTSW 7 11162439 missense possibly damaging 0.85
R7726:Zscan4d UTSW 7 11165242 missense possibly damaging 0.65
R7772:Zscan4d UTSW 7 11162843 missense probably benign 0.28
R8282:Zscan4d UTSW 7 11162442 missense possibly damaging 0.91
R8320:Zscan4d UTSW 7 11066015 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGACAGTACAATTTACTTGCAAC -3'
(R):5'- AAACATGCCAGGAGCCTTTCG -3'

Sequencing Primer
(F):5'- GCAACATTCTTCTCTCTTTGAAGATG -3'
(R):5'- AGAAGAGTGAATTGCTTTGTGTCACC -3'
Posted On 2018-06-22