Incidental Mutation 'R6571:Camsap1'
ID526226
Institutional Source Beutler Lab
Gene Symbol Camsap1
Ensembl Gene ENSMUSG00000026933
Gene Namecalmodulin regulated spectrin-associated protein 1
Synonyms9530003A05Rik, PRO2405
MMRRC Submission
Accession Numbers

Genbank: NM_001115076; MGI: 3036242

Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R6571 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25926838-25983282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25939500 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 757 (D757E)
Ref Sequence ENSEMBL: ENSMUSP00000117203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091268] [ENSMUST00000114167] [ENSMUST00000134882] [ENSMUST00000183461]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091268
AA Change: D737E

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088812
Gene: ENSMUSG00000026933
AA Change: D737E

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 228 311 3.3e-35 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
Pfam:CAMSAP_CC1 859 917 3.8e-29 PFAM
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114167
AA Change: D737E

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109804
Gene: ENSMUSG00000026933
AA Change: D737E

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134882
AA Change: D757E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117203
Gene: ENSMUSG00000026933
AA Change: D757E

DomainStartEndE-ValueType
Pfam:CH 185 350 1.3e-33 PFAM
Pfam:CAMSAP_CH 248 331 2.6e-34 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
coiled coil region 889 925 N/A INTRINSIC
coiled coil region 1030 1057 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134970
Predicted Effect probably benign
Transcript: ENSMUST00000143977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148146
Predicted Effect possibly damaging
Transcript: ENSMUST00000183461
AA Change: D737E

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139028
Gene: ENSMUSG00000026933
AA Change: D737E

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 94% (31/33)
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,982 D394G probably benign Het
9130019O22Rik T C 7: 127,385,138 probably benign Het
Acsl6 A G 11: 54,325,564 I161V possibly damaging Het
Adamts12 T C 15: 11,065,101 F24S probably benign Het
Bche G T 3: 73,701,491 Q201K probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dab2ip T C 2: 35,712,890 S399P probably damaging Het
Fbxo40 A T 16: 36,969,306 C481S probably damaging Het
Fn1 T A 1: 71,626,190 T923S probably damaging Het
Gm11437 T C 11: 84,156,212 D147G probably benign Het
Gm5592 A G 7: 41,288,575 E427G probably damaging Het
Gm6401 T A 14: 41,965,495 I125F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Inpp4a T C 1: 37,387,758 M600T probably damaging Het
Itgb6 T C 2: 60,628,456 E374G probably damaging Het
Lrba A C 3: 86,360,060 S1686R probably damaging Het
Map3k4 T C 17: 12,242,692 D1200G possibly damaging Het
Mmp25 T C 17: 23,639,896 H227R probably benign Het
Olfr768 A C 10: 129,093,121 N284K probably damaging Het
Papss2 G A 19: 32,651,942 probably null Het
Rasal2 T A 1: 157,161,179 R718S possibly damaging Het
Rngtt T A 4: 33,379,413 D438E probably damaging Het
S1pr1 A G 3: 115,711,803 S381P possibly damaging Het
Sept8 A G 11: 53,537,163 E268G probably damaging Het
Slc6a21 A G 7: 45,280,879 K234R probably damaging Het
Smg1 A G 7: 118,184,514 probably benign Het
Sntg1 T C 1: 8,363,528 probably benign Het
Spag5 G T 11: 78,321,269 R1041I probably damaging Het
Spata31d1b A T 13: 59,717,455 M806L probably benign Het
Tnfrsf18 T A 4: 156,028,319 L154* probably null Het
Trib2 T C 12: 15,794,059 E194G probably damaging Het
Vmn2r33 A G 7: 7,563,669 V148A probably benign Het
Wiz G A 17: 32,359,324 R405W probably damaging Het
Other mutations in Camsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Camsap1 APN 2 25933623 missense possibly damaging 0.95
IGL01555:Camsap1 APN 2 25939393 missense possibly damaging 0.81
IGL01667:Camsap1 APN 2 25945281 splice site probably benign
IGL02167:Camsap1 APN 2 25934300 missense probably damaging 1.00
IGL02191:Camsap1 APN 2 25929880 missense probably damaging 0.97
IGL02285:Camsap1 APN 2 25929802 missense probably damaging 1.00
IGL02393:Camsap1 APN 2 25938322 missense probably benign 0.10
3-1:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R0631:Camsap1 UTSW 2 25933647 missense probably damaging 0.98
R0828:Camsap1 UTSW 2 25939085 missense probably damaging 1.00
R1434:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R1687:Camsap1 UTSW 2 25939615 missense probably damaging 1.00
R2027:Camsap1 UTSW 2 25938526 missense possibly damaging 0.51
R2048:Camsap1 UTSW 2 25929743 missense probably benign 0.00
R3732:Camsap1 UTSW 2 25938344 missense probably damaging 1.00
R4437:Camsap1 UTSW 2 25938646 missense possibly damaging 0.89
R4494:Camsap1 UTSW 2 25952758 missense probably damaging 1.00
R4888:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5028:Camsap1 UTSW 2 25944556 missense probably damaging 1.00
R5058:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R5105:Camsap1 UTSW 2 25940929 missense probably damaging 1.00
R5121:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5153:Camsap1 UTSW 2 25933618 missense probably damaging 1.00
R5323:Camsap1 UTSW 2 25965811 missense probably damaging 0.98
R6043:Camsap1 UTSW 2 25929925 missense probably benign 0.00
R6479:Camsap1 UTSW 2 25935862 missense possibly damaging 0.88
R6502:Camsap1 UTSW 2 25956308 missense probably damaging 1.00
R7046:Camsap1 UTSW 2 25945189 missense probably damaging 0.99
R7251:Camsap1 UTSW 2 25938886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGTGGTGCTCAGACACG -3'
(R):5'- TGATCTTGCGGAGGTAGGAC -3'

Sequencing Primer
(F):5'- TGCTCAGACACGGGCTTGAG -3'
(R):5'- CTACAGGGGAAGGACAGCCTC -3'
Posted On2018-06-22