Incidental Mutation 'R6571:Rngtt'
ID526232
Institutional Source Beutler Lab
Gene Symbol Rngtt
Ensembl Gene ENSMUSG00000028274
Gene NameRNA guanylyltransferase and 5'-phosphatase
Synonymsmouse capping enzyme
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6571 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location33310311-33502614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33379413 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 438 (D438E)
Ref Sequence ENSEMBL: ENSMUSP00000103788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029942] [ENSMUST00000108153]
PDB Structure
CRYSTAL STRUCTURE OF THE RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE OXIDIZED RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
Crystal structure of mammalian capping enzyme (Mce1) and Pol II CTD complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029942
AA Change: D438E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029942
Gene: ENSMUSG00000028274
AA Change: D438E

DomainStartEndE-ValueType
Pfam:DSPc 46 179 4.7e-12 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 1.8e-73 PFAM
Pfam:mRNA_cap_C 463 550 3.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108153
AA Change: D438E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103788
Gene: ENSMUSG00000028274
AA Change: D438E

DomainStartEndE-ValueType
Pfam:DSPc 47 179 2.2e-13 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 2e-80 PFAM
Pfam:mRNA_cap_C 464 559 1.9e-22 PFAM
low complexity region 577 590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,982 D394G probably benign Het
9130019O22Rik T C 7: 127,385,138 probably benign Het
Acsl6 A G 11: 54,325,564 I161V possibly damaging Het
Adamts12 T C 15: 11,065,101 F24S probably benign Het
Bche G T 3: 73,701,491 Q201K probably benign Het
Camsap1 A T 2: 25,939,500 D757E possibly damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dab2ip T C 2: 35,712,890 S399P probably damaging Het
Fbxo40 A T 16: 36,969,306 C481S probably damaging Het
Fn1 T A 1: 71,626,190 T923S probably damaging Het
Gm11437 T C 11: 84,156,212 D147G probably benign Het
Gm5592 A G 7: 41,288,575 E427G probably damaging Het
Gm6401 T A 14: 41,965,495 I125F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Inpp4a T C 1: 37,387,758 M600T probably damaging Het
Itgb6 T C 2: 60,628,456 E374G probably damaging Het
Lrba A C 3: 86,360,060 S1686R probably damaging Het
Map3k4 T C 17: 12,242,692 D1200G possibly damaging Het
Mmp25 T C 17: 23,639,896 H227R probably benign Het
Olfr768 A C 10: 129,093,121 N284K probably damaging Het
Papss2 G A 19: 32,651,942 probably null Het
Rasal2 T A 1: 157,161,179 R718S possibly damaging Het
S1pr1 A G 3: 115,711,803 S381P possibly damaging Het
Sept8 A G 11: 53,537,163 E268G probably damaging Het
Slc6a21 A G 7: 45,280,879 K234R probably damaging Het
Smg1 A G 7: 118,184,514 probably benign Het
Sntg1 T C 1: 8,363,528 probably benign Het
Spag5 G T 11: 78,321,269 R1041I probably damaging Het
Spata31d1b A T 13: 59,717,455 M806L probably benign Het
Tnfrsf18 T A 4: 156,028,319 L154* probably null Het
Trib2 T C 12: 15,794,059 E194G probably damaging Het
Vmn2r33 A G 7: 7,563,669 V148A probably benign Het
Wiz G A 17: 32,359,324 R405W probably damaging Het
Other mutations in Rngtt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Rngtt APN 4 33325157 splice site probably benign
IGL01945:Rngtt APN 4 33339073 missense probably damaging 1.00
IGL02104:Rngtt APN 4 33320517 critical splice acceptor site probably null
IGL02505:Rngtt APN 4 33337936 missense possibly damaging 0.75
IGL02679:Rngtt APN 4 33356098 missense possibly damaging 0.65
IGL03309:Rngtt APN 4 33339091 missense probably damaging 1.00
R0013:Rngtt UTSW 4 33379409 missense probably benign 0.01
R0626:Rngtt UTSW 4 33329598 splice site probably null
R0633:Rngtt UTSW 4 33368690 missense probably damaging 1.00
R1645:Rngtt UTSW 4 33362939 missense probably damaging 1.00
R1670:Rngtt UTSW 4 33368660 missense probably benign
R1700:Rngtt UTSW 4 33330864 missense probably damaging 1.00
R1754:Rngtt UTSW 4 33329634 splice site probably null
R1809:Rngtt UTSW 4 33443614 missense probably benign 0.04
R1929:Rngtt UTSW 4 33500302 nonsense probably null
R2271:Rngtt UTSW 4 33500302 nonsense probably null
R2844:Rngtt UTSW 4 33368678 missense probably benign
R3773:Rngtt UTSW 4 33330889 missense probably damaging 1.00
R4445:Rngtt UTSW 4 33499035 missense probably benign
R4449:Rngtt UTSW 4 33330865 missense probably damaging 1.00
R4510:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4511:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4578:Rngtt UTSW 4 33339050 missense probably benign 0.30
R4610:Rngtt UTSW 4 33339133 intron probably benign
R4712:Rngtt UTSW 4 33379394 missense probably benign 0.00
R4888:Rngtt UTSW 4 33500335 missense unknown
R4911:Rngtt UTSW 4 33500292 splice site probably null
R5248:Rngtt UTSW 4 33325110 nonsense probably null
R6429:Rngtt UTSW 4 33320606 nonsense probably null
R7260:Rngtt UTSW 4 33356176 missense possibly damaging 0.52
R7298:Rngtt UTSW 4 33362927 missense probably damaging 1.00
R7379:Rngtt UTSW 4 33498981 nonsense probably null
R8163:Rngtt UTSW 4 33325109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGAAGTCACACATTAGGACCC -3'
(R):5'- TGGTACACCAAACTACAAGAGG -3'

Sequencing Primer
(F):5'- CAAGGTCACAGAGTTTAATCCAG -3'
(R):5'- CCAAACTACAAGAGGAAATAAGCAG -3'
Posted On2018-06-22