Mutagenetix > Incidental Mutation

Incidental Mutation 'R6571:Map3k4'

526250

Institutional Source

Beutler Lab

Gene Symbol

Map3k4

Ensembl Gene

ENSMUSG00000014426

Gene Name

mitogen-activated protein kinase kinase kinase 4

Synonyms

T-associated sex reversal, D17Rp17, D17Rp17e, Mekk4, Tas, RP17, MAPKKK4, MTK1

MMRRC Submission

044695-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R6571 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12446508-12537683 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12461579 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1200 (D1200G)

Ref Sequence

ENSEMBL: ENSMUSP00000086459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089058]

AlphaFold

O08648

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089058
AA Change: D1200G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: D1200G

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	27	43	N/A	INTRINSIC
low complexity region	215	235	N/A	INTRINSIC
low complexity region	432	462	N/A	INTRINSIC
low complexity region	1177	1191	N/A	INTRINSIC
S_TKc	1332	1590	1.41e-91	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

94% (31/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	A	G	11: 54,216,390 (GRCm39)	I161V	possibly damaging	Het
Adamts12	T	C	15: 11,065,187 (GRCm39)	F24S	probably benign	Het
Bche	G	T	3: 73,608,824 (GRCm39)	Q201K	probably benign	Het
Camsap1	A	T	2: 25,829,512 (GRCm39)	D757E	possibly damaging	Het
Crebbp	C	T	16: 3,937,670 (GRCm39)	A698T	possibly damaging	Het
Dab2ip	T	C	2: 35,602,902 (GRCm39)	S399P	probably damaging	Het
Fbxo40	A	T	16: 36,789,668 (GRCm39)	C481S	probably damaging	Het
Fn1	T	A	1: 71,665,349 (GRCm39)	T923S	probably damaging	Het
Gm11437	T	C	11: 84,047,038 (GRCm39)	D147G	probably benign	Het
Gm5592	A	G	7: 40,937,999 (GRCm39)	E427G	probably damaging	Het
Gm6401	T	A	14: 41,787,452 (GRCm39)	I125F	probably damaging	Het
Hmcn1	A	T	1: 150,491,189 (GRCm39)		probably null	Het
Inpp4a	T	C	1: 37,426,839 (GRCm39)	M600T	probably damaging	Het
Itgb6	T	C	2: 60,458,800 (GRCm39)	E374G	probably damaging	Het
Lrba	A	C	3: 86,267,367 (GRCm39)	S1686R	probably damaging	Het
Mmp25	T	C	17: 23,858,870 (GRCm39)	H227R	probably benign	Het
Or6c38	A	C	10: 128,928,990 (GRCm39)	N284K	probably damaging	Het
Papss2	G	A	19: 32,629,342 (GRCm39)		probably null	Het
Rasal2	T	A	1: 156,988,749 (GRCm39)	R718S	possibly damaging	Het
Relch	A	G	1: 105,620,707 (GRCm39)	D394G	probably benign	Het
Rngtt	T	A	4: 33,379,413 (GRCm39)	D438E	probably damaging	Het
S1pr1	A	G	3: 115,505,452 (GRCm39)	S381P	possibly damaging	Het
Septin8	A	G	11: 53,427,990 (GRCm39)	E268G	probably damaging	Het
Slc6a21	A	G	7: 44,930,303 (GRCm39)	K234R	probably damaging	Het
Smg1	A	G	7: 117,783,737 (GRCm39)		probably benign	Het
Sntg1	T	C	1: 8,433,752 (GRCm39)		probably benign	Het
Spag5	G	T	11: 78,212,095 (GRCm39)	R1041I	probably damaging	Het
Spata31d1b	A	T	13: 59,865,269 (GRCm39)	M806L	probably benign	Het
Tnfrsf18	T	A	4: 156,112,776 (GRCm39)	L154*	probably null	Het
Trib2	T	C	12: 15,844,060 (GRCm39)	E194G	probably damaging	Het
Vmn2r33	A	G	7: 7,566,668 (GRCm39)	V148A	probably benign	Het
Wiz	G	A	17: 32,578,298 (GRCm39)	R405W	probably damaging	Het
Zfp747l1	T	C	7: 126,984,310 (GRCm39)		probably benign	Het

Other mutations in Map3k4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Map3k4	APN	17	12,451,877 (GRCm39)	missense	probably damaging	1.00
IGL01124:Map3k4	APN	17	12,474,087 (GRCm39)	missense	probably benign	0.01
IGL01125:Map3k4	APN	17	12,490,849 (GRCm39)	missense	probably damaging	0.96
IGL01585:Map3k4	APN	17	12,467,846 (GRCm39)	missense	probably damaging	1.00
IGL02194:Map3k4	APN	17	12,482,815 (GRCm39)	missense	probably damaging	1.00
IGL02194:Map3k4	APN	17	12,467,882 (GRCm39)	missense	probably benign	0.30
IGL02292:Map3k4	APN	17	12,454,045 (GRCm39)	missense	possibly damaging	0.77
IGL02326:Map3k4	APN	17	12,467,897 (GRCm39)	missense	probably damaging	1.00
IGL02388:Map3k4	APN	17	12,490,497 (GRCm39)	missense	probably damaging	0.99
IGL02621:Map3k4	APN	17	12,482,900 (GRCm39)	missense	probably damaging	1.00
IGL02668:Map3k4	APN	17	12,454,840 (GRCm39)	missense	possibly damaging	0.85
IGL02850:Map3k4	APN	17	12,490,801 (GRCm39)	missense	probably damaging	1.00
IGL02939:Map3k4	APN	17	12,491,036 (GRCm39)	missense	probably damaging	1.00
IGL03148:Map3k4	APN	17	12,457,045 (GRCm39)	missense	probably benign	0.01
IGL03238:Map3k4	APN	17	12,490,045 (GRCm39)	missense	probably benign	0.10
ANU74:Map3k4	UTSW	17	12,451,863 (GRCm39)	missense	probably damaging	1.00
R0012:Map3k4	UTSW	17	12,457,076 (GRCm39)	missense	probably damaging	1.00
R0012:Map3k4	UTSW	17	12,457,076 (GRCm39)	missense	probably damaging	1.00
R0128:Map3k4	UTSW	17	12,466,950 (GRCm39)	missense	probably damaging	0.99
R0183:Map3k4	UTSW	17	12,454,015 (GRCm39)	missense	probably damaging	1.00
R0309:Map3k4	UTSW	17	12,489,902 (GRCm39)	frame shift	probably null
R0355:Map3k4	UTSW	17	12,473,058 (GRCm39)	missense	probably damaging	1.00
R0367:Map3k4	UTSW	17	12,476,928 (GRCm39)	splice site	probably benign
R1103:Map3k4	UTSW	17	12,455,950 (GRCm39)	splice site	probably null
R1446:Map3k4	UTSW	17	12,475,681 (GRCm39)	nonsense	probably null
R1542:Map3k4	UTSW	17	12,454,793 (GRCm39)	missense	probably damaging	0.97
R1713:Map3k4	UTSW	17	12,468,458 (GRCm39)	missense	probably benign	0.39
R1777:Map3k4	UTSW	17	12,490,617 (GRCm39)	missense	possibly damaging	0.82
R1797:Map3k4	UTSW	17	12,482,906 (GRCm39)	missense	probably benign	0.30
R1997:Map3k4	UTSW	17	12,473,882 (GRCm39)	critical splice donor site	probably null
R2042:Map3k4	UTSW	17	12,496,870 (GRCm39)	missense	probably damaging	0.99
R2878:Map3k4	UTSW	17	12,482,954 (GRCm39)	missense	probably benign	0.00
R2939:Map3k4	UTSW	17	12,480,157 (GRCm39)	missense	probably damaging	0.98
R2940:Map3k4	UTSW	17	12,480,157 (GRCm39)	missense	probably damaging	0.98
R3405:Map3k4	UTSW	17	12,475,668 (GRCm39)	missense	probably damaging	1.00
R3930:Map3k4	UTSW	17	12,454,880 (GRCm39)	missense	possibly damaging	0.83
R4291:Map3k4	UTSW	17	12,474,147 (GRCm39)	missense	probably benign	0.08
R4410:Map3k4	UTSW	17	12,467,885 (GRCm39)	missense	probably damaging	1.00
R4632:Map3k4	UTSW	17	12,451,391 (GRCm39)	missense	probably damaging	1.00
R4641:Map3k4	UTSW	17	12,482,932 (GRCm39)	missense	probably damaging	1.00
R4726:Map3k4	UTSW	17	12,451,851 (GRCm39)	missense	possibly damaging	0.89
R4730:Map3k4	UTSW	17	12,467,861 (GRCm39)	missense	probably damaging	0.99
R4832:Map3k4	UTSW	17	12,490,667 (GRCm39)	missense	probably damaging	1.00
R4896:Map3k4	UTSW	17	12,490,906 (GRCm39)	missense	possibly damaging	0.65
R4934:Map3k4	UTSW	17	12,490,787 (GRCm39)	missense	probably damaging	1.00
R4971:Map3k4	UTSW	17	12,468,382 (GRCm39)	critical splice donor site	probably null
R4980:Map3k4	UTSW	17	12,490,958 (GRCm39)	missense	probably damaging	1.00
R5211:Map3k4	UTSW	17	12,451,321 (GRCm39)	missense	possibly damaging	0.88
R5337:Map3k4	UTSW	17	12,490,497 (GRCm39)	missense	probably damaging	0.99
R5356:Map3k4	UTSW	17	12,466,195 (GRCm39)	missense	possibly damaging	0.87
R5550:Map3k4	UTSW	17	12,462,445 (GRCm39)	nonsense	probably null
R5824:Map3k4	UTSW	17	12,448,526 (GRCm39)	missense	probably damaging	1.00
R5890:Map3k4	UTSW	17	12,490,303 (GRCm39)	missense	probably damaging	1.00
R6285:Map3k4	UTSW	17	12,482,945 (GRCm39)	missense	probably damaging	1.00
R6380:Map3k4	UTSW	17	12,490,954 (GRCm39)	missense	possibly damaging	0.56
R6383:Map3k4	UTSW	17	12,468,470 (GRCm39)	missense	possibly damaging	0.82
R6584:Map3k4	UTSW	17	12,479,378 (GRCm39)	missense	probably damaging	1.00
R6616:Map3k4	UTSW	17	12,490,231 (GRCm39)	missense	probably damaging	1.00
R6644:Map3k4	UTSW	17	12,451,297 (GRCm39)	critical splice donor site	probably null
R6909:Map3k4	UTSW	17	12,489,872 (GRCm39)	missense	probably damaging	1.00
R6947:Map3k4	UTSW	17	12,479,456 (GRCm39)	nonsense	probably null
R6970:Map3k4	UTSW	17	12,467,803 (GRCm39)	missense	probably damaging	1.00
R7120:Map3k4	UTSW	17	12,490,354 (GRCm39)	missense	probably damaging	1.00
R7253:Map3k4	UTSW	17	12,490,955 (GRCm39)	missense	probably benign	0.00
R7267:Map3k4	UTSW	17	12,490,536 (GRCm39)	nonsense	probably null
R7322:Map3k4	UTSW	17	12,489,833 (GRCm39)	missense	probably damaging	1.00
R7522:Map3k4	UTSW	17	12,480,219 (GRCm39)	missense	probably benign	0.39
R7554:Map3k4	UTSW	17	12,451,301 (GRCm39)	nonsense	probably null
R7554:Map3k4	UTSW	17	12,451,300 (GRCm39)	missense	probably damaging	1.00
R7681:Map3k4	UTSW	17	12,537,430 (GRCm39)	missense	unknown
R7734:Map3k4	UTSW	17	12,482,998 (GRCm39)	missense	probably damaging	1.00
R7842:Map3k4	UTSW	17	12,490,030 (GRCm39)	missense	possibly damaging	0.54
R8013:Map3k4	UTSW	17	12,489,918 (GRCm39)	nonsense	probably null
R8014:Map3k4	UTSW	17	12,489,918 (GRCm39)	nonsense	probably null
R8235:Map3k4	UTSW	17	12,458,968 (GRCm39)	splice site	probably null
R8294:Map3k4	UTSW	17	12,537,500 (GRCm39)	missense	unknown
R8528:Map3k4	UTSW	17	12,451,821 (GRCm39)	missense	probably damaging	1.00
R8858:Map3k4	UTSW	17	12,490,759 (GRCm39)	missense	probably damaging	1.00
R8924:Map3k4	UTSW	17	12,490,433 (GRCm39)	missense	probably benign	0.00
R9063:Map3k4	UTSW	17	12,482,878 (GRCm39)	missense	probably damaging	1.00
R9224:Map3k4	UTSW	17	12,456,973 (GRCm39)	missense	probably damaging	0.99
R9446:Map3k4	UTSW	17	12,451,375 (GRCm39)	missense	probably damaging	1.00
R9486:Map3k4	UTSW	17	12,489,860 (GRCm39)	missense	probably damaging	1.00
R9488:Map3k4	UTSW	17	12,489,860 (GRCm39)	missense	probably damaging	1.00
R9591:Map3k4	UTSW	17	12,454,795 (GRCm39)	missense	possibly damaging	0.91
R9617:Map3k4	UTSW	17	12,476,871 (GRCm39)	missense	possibly damaging	0.67
R9722:Map3k4	UTSW	17	12,490,523 (GRCm39)	missense	probably benign	0.01
X0067:Map3k4	UTSW	17	12,482,981 (GRCm39)	missense	probably benign	0.03
Z1177:Map3k4	UTSW	17	12,490,584 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAGGCTCTAACAACCCAC -3'
(R):5'- CAGAACTCTCAAATAGCAATGTGC -3'

Sequencing Primer
(F):5'- TGTGACACATCCTGACAC -3'
(R):5'- ATTTCCTACCCATGTATCACATACC -3'

Posted On

2018-06-22