Incidental Mutation 'R6572:Inpp5d'
ID526254
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R6572 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87695396 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 403 (P403S)
Ref Sequence ENSEMBL: ENSMUSP00000044647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
Predicted Effect probably damaging
Transcript: ENSMUST00000042275
AA Change: P403S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: P403S

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072999
AA Change: P403S

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: P403S

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167032
AA Change: P141S

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: P141S

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168783
AA Change: P404S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: P404S

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169754
AA Change: P404S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: P404S

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170300
AA Change: P141S

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: P141S

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,717 Q34* probably null Het
Adamts3 T A 5: 89,861,609 H65L possibly damaging Het
Ago2 A G 15: 73,126,977 V257A probably benign Het
Ahnak A G 19: 9,007,976 K2208R probably damaging Het
Apc2 C T 10: 80,311,779 S860L probably damaging Het
Arhgap18 A G 10: 26,846,416 probably null Het
Arhgap33 T C 7: 30,527,210 E524G probably damaging Het
Ascc3 C T 10: 50,690,247 Q763* probably null Het
Atg2a T C 19: 6,254,665 L1184P probably damaging Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Btbd17 A T 11: 114,792,220 L222Q probably damaging Het
Chst13 G T 6: 90,309,606 R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Cracr2a T C 6: 127,608,752 probably null Het
Dchs1 T A 7: 105,758,806 T1940S possibly damaging Het
Ddit4l G T 3: 137,626,350 R159L probably benign Het
Dock3 A G 9: 106,989,475 Y679H probably damaging Het
Dyrk4 T G 6: 126,897,238 I130L probably benign Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Ephb1 A G 9: 102,066,898 F312L probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Fndc9 A T 11: 46,237,881 I76F probably damaging Het
Frk G A 10: 34,583,967 R186K probably benign Het
Gpatch3 G T 4: 133,574,880 G41C probably damaging Het
Greb1l T A 18: 10,522,131 H633Q probably benign Het
Gstt4 T A 10: 75,815,120 T223S probably damaging Het
Hpd C T 5: 123,180,676 E60K probably benign Het
Klk1b9 T A 7: 43,979,735 I189K probably benign Het
Kmt2e A T 5: 23,497,581 H239L possibly damaging Het
Lrriq3 A G 3: 155,181,675 D344G probably benign Het
Neb A G 2: 52,278,847 I1892T probably damaging Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nipal3 A T 4: 135,447,253 S396T probably benign Het
Olfr395 A G 11: 73,906,803 S230P possibly damaging Het
Olfr638 T A 7: 103,999,184 probably null Het
Phf20l1 T A 15: 66,609,547 V264D probably damaging Het
Pigs A G 11: 78,339,364 Y319C probably damaging Het
Pkd2l2 T C 18: 34,438,771 Y608H probably damaging Het
Ppard G T 17: 28,297,119 E106* probably null Het
Pramef25 A G 4: 143,949,692 S281P probably benign Het
Pramef6 C T 4: 143,895,373 V471I possibly damaging Het
Psenen T C 7: 30,562,348 T48A probably benign Het
Ralgps2 A T 1: 156,824,050 probably null Het
Ripk4 T A 16: 97,745,905 R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Scgb2b24 T A 7: 33,738,477 E68D probably damaging Het
Setx A G 2: 29,173,694 D2334G possibly damaging Het
Sh3bp4 A G 1: 89,144,921 D497G possibly damaging Het
Smarca2 A T 19: 26,679,173 I850F possibly damaging Het
Smyd1 A G 6: 71,225,412 Y270H probably damaging Het
Spidr T A 16: 15,912,516 probably null Het
Srms T C 2: 181,212,657 D39G probably benign Het
Trpc2 T A 7: 102,090,006 I528N probably damaging Het
Tshr A G 12: 91,538,360 I691V probably benign Het
Urb1 A C 16: 90,787,414 V560G probably benign Het
Usp37 A G 1: 74,495,782 S2P possibly damaging Het
Vmn1r60 G A 7: 5,544,600 S167F probably benign Het
Vmn2r89 G A 14: 51,455,993 V267I probably damaging Het
Washc3 T A 10: 88,213,706 D63E probably benign Het
Wdr89 A G 12: 75,633,385 S32P probably damaging Het
Zfp157 T C 5: 138,457,051 S504P possibly damaging Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
Apfelsine UTSW 1 87683845 nonsense probably null
auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
Salamander UTSW 1 87695380 missense probably damaging 0.99
Sandstone UTSW 1 87695400 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87665399 missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87699672 missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87683845 nonsense probably null
Z1176:Inpp5d UTSW 1 87669709 missense probably benign 0.16
Z1176:Inpp5d UTSW 1 87703131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGAATGCATCTCTCCGGG -3'
(R):5'- TTGTATAGATGGGATTGAGACCAG -3'

Sequencing Primer
(F):5'- ATCTCTCCGGGTGGCTG -3'
(R):5'- TTGAGACCAGGACTATGGCTG -3'
Posted On2018-06-22