Incidental Mutation 'R6572:Adamts3'
ID 526266
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 044696-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6572 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90009468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 65 (H65L)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]
AlphaFold E9Q287
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: H65L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: H65L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163159
AA Change: H65L

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: H65L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196507
Predicted Effect possibly damaging
Transcript: ENSMUST00000198151
AA Change: H65L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: H65L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 174 2.3e-29 PFAM
Meta Mutation Damage Score 0.0780 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,961 (GRCm39) Q34* probably null Het
Ago2 A G 15: 72,998,826 (GRCm39) V257A probably benign Het
Ahnak A G 19: 8,985,340 (GRCm39) K2208R probably damaging Het
Apc2 C T 10: 80,147,613 (GRCm39) S860L probably damaging Het
Arhgap18 A G 10: 26,722,412 (GRCm39) probably null Het
Arhgap33 T C 7: 30,226,635 (GRCm39) E524G probably damaging Het
Ascc3 C T 10: 50,566,343 (GRCm39) Q763* probably null Het
Atg2a T C 19: 6,304,695 (GRCm39) L1184P probably damaging Het
Baiap2l1 A G 5: 144,223,112 (GRCm39) L75P probably damaging Het
Btbd17 A T 11: 114,683,046 (GRCm39) L222Q probably damaging Het
Chst13 G T 6: 90,286,588 (GRCm39) R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,481,655 (GRCm39) probably null Het
Cracr2a T C 6: 127,585,715 (GRCm39) probably null Het
Dchs1 T A 7: 105,408,013 (GRCm39) T1940S possibly damaging Het
Ddit4l G T 3: 137,332,111 (GRCm39) R159L probably benign Het
Dock3 A G 9: 106,866,674 (GRCm39) Y679H probably damaging Het
Dyrk4 T G 6: 126,874,201 (GRCm39) I130L probably benign Het
Eml2 T C 7: 18,930,539 (GRCm39) V373A possibly damaging Het
Entrep1 A T 19: 23,962,082 (GRCm39) M307K possibly damaging Het
Ephb1 A G 9: 101,944,097 (GRCm39) F312L probably benign Het
Fndc9 A T 11: 46,128,708 (GRCm39) I76F probably damaging Het
Frk G A 10: 34,459,963 (GRCm39) R186K probably benign Het
Gpatch3 G T 4: 133,302,191 (GRCm39) G41C probably damaging Het
Greb1l T A 18: 10,522,131 (GRCm39) H633Q probably benign Het
Gstt4 T A 10: 75,650,954 (GRCm39) T223S probably damaging Het
Hpd C T 5: 123,318,739 (GRCm39) E60K probably benign Het
Inpp5d C T 1: 87,623,118 (GRCm39) P403S probably damaging Het
Klk1b9 T A 7: 43,629,159 (GRCm39) I189K probably benign Het
Kmt2e A T 5: 23,702,579 (GRCm39) H239L possibly damaging Het
Lrriq3 A G 3: 154,887,312 (GRCm39) D344G probably benign Het
Neb A G 2: 52,168,859 (GRCm39) I1892T probably damaging Het
Neto2 A T 8: 86,397,033 (GRCm39) I73N possibly damaging Het
Nipal3 A T 4: 135,174,564 (GRCm39) S396T probably benign Het
Or1e35 A G 11: 73,797,629 (GRCm39) S230P possibly damaging Het
Or51q1c T A 7: 103,648,391 (GRCm39) probably null Het
Phf20l1 T A 15: 66,481,396 (GRCm39) V264D probably damaging Het
Pigs A G 11: 78,230,190 (GRCm39) Y319C probably damaging Het
Pkd2l2 T C 18: 34,571,824 (GRCm39) Y608H probably damaging Het
Ppard G T 17: 28,516,093 (GRCm39) E106* probably null Het
Pramel11 C T 4: 143,621,943 (GRCm39) V471I possibly damaging Het
Pramel16 A G 4: 143,676,262 (GRCm39) S281P probably benign Het
Psenen T C 7: 30,261,773 (GRCm39) T48A probably benign Het
Ralgps2 A T 1: 156,651,620 (GRCm39) probably null Het
Ripk4 T A 16: 97,547,105 (GRCm39) R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Scgb2b24 T A 7: 33,437,902 (GRCm39) E68D probably damaging Het
Setx A G 2: 29,063,706 (GRCm39) D2334G possibly damaging Het
Sh3bp4 A G 1: 89,072,643 (GRCm39) D497G possibly damaging Het
Smarca2 A T 19: 26,656,573 (GRCm39) I850F possibly damaging Het
Smyd1 A G 6: 71,202,396 (GRCm39) Y270H probably damaging Het
Spidr T A 16: 15,730,380 (GRCm39) probably null Het
Srms T C 2: 180,854,450 (GRCm39) D39G probably benign Het
Trpc2 T A 7: 101,739,213 (GRCm39) I528N probably damaging Het
Tshr A G 12: 91,505,134 (GRCm39) I691V probably benign Het
Urb1 A C 16: 90,584,302 (GRCm39) V560G probably benign Het
Usp37 A G 1: 74,534,941 (GRCm39) S2P possibly damaging Het
Vmn1r60 G A 7: 5,547,599 (GRCm39) S167F probably benign Het
Vmn2r89 G A 14: 51,693,450 (GRCm39) V267I probably damaging Het
Washc3 T A 10: 88,049,568 (GRCm39) D63E probably benign Het
Wdr89 A G 12: 75,680,159 (GRCm39) S32P probably damaging Het
Zfp157 T C 5: 138,455,313 (GRCm39) S504P possibly damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCACTTCCGTGTAGATGGC -3'
(R):5'- AGGATAGATTTCATCACCAAGCATG -3'

Sequencing Primer
(F):5'- CACTTCCGTGTAGATGGCTGTTTC -3'
(R):5'- AGCATGGCTTAGCTTTGTGAG -3'
Posted On 2018-06-22