Incidental Mutation 'R6572:Smyd1'
ID526270
Institutional Source Beutler Lab
Gene Symbol Smyd1
Ensembl Gene ENSMUSG00000055027
Gene NameSET and MYND domain containing 1
SynonymsBop, 4632404M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6572 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71213940-71322233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71225412 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 270 (Y270H)
Ref Sequence ENSEMBL: ENSMUSP00000073911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074301] [ENSMUST00000114186] [ENSMUST00000114188]
PDB Structure
Crystal structure of cardiac specific histone methyltransferase SmyD1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000074301
AA Change: Y270H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073911
Gene: ENSMUSG00000055027
AA Change: Y270H

DomainStartEndE-ValueType
SET 7 259 2.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114186
AA Change: Y257H

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109824
Gene: ENSMUSG00000055027
AA Change: Y257H

DomainStartEndE-ValueType
SET 7 246 2.45e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114188
AA Change: Y236H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109826
Gene: ENSMUSG00000055027
AA Change: Y236H

DomainStartEndE-ValueType
Pfam:zf-MYND 18 56 5.4e-11 PFAM
SET 76 225 1.53e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at E10.5. Mutant embryos exhibit an enlarged heart and developmental abnormalities of the right ventricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,717 Q34* probably null Het
Adamts3 T A 5: 89,861,609 H65L possibly damaging Het
Ago2 A G 15: 73,126,977 V257A probably benign Het
Ahnak A G 19: 9,007,976 K2208R probably damaging Het
Apc2 C T 10: 80,311,779 S860L probably damaging Het
Arhgap18 A G 10: 26,846,416 probably null Het
Arhgap33 T C 7: 30,527,210 E524G probably damaging Het
Ascc3 C T 10: 50,690,247 Q763* probably null Het
Atg2a T C 19: 6,254,665 L1184P probably damaging Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Btbd17 A T 11: 114,792,220 L222Q probably damaging Het
Chst13 G T 6: 90,309,606 R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Cracr2a T C 6: 127,608,752 probably null Het
Dchs1 T A 7: 105,758,806 T1940S possibly damaging Het
Ddit4l G T 3: 137,626,350 R159L probably benign Het
Dock3 A G 9: 106,989,475 Y679H probably damaging Het
Dyrk4 T G 6: 126,897,238 I130L probably benign Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Ephb1 A G 9: 102,066,898 F312L probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Fndc9 A T 11: 46,237,881 I76F probably damaging Het
Frk G A 10: 34,583,967 R186K probably benign Het
Gpatch3 G T 4: 133,574,880 G41C probably damaging Het
Greb1l T A 18: 10,522,131 H633Q probably benign Het
Gstt4 T A 10: 75,815,120 T223S probably damaging Het
Hpd C T 5: 123,180,676 E60K probably benign Het
Inpp5d C T 1: 87,695,396 P403S probably damaging Het
Klk1b9 T A 7: 43,979,735 I189K probably benign Het
Kmt2e A T 5: 23,497,581 H239L possibly damaging Het
Lrriq3 A G 3: 155,181,675 D344G probably benign Het
Neb A G 2: 52,278,847 I1892T probably damaging Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nipal3 A T 4: 135,447,253 S396T probably benign Het
Olfr395 A G 11: 73,906,803 S230P possibly damaging Het
Olfr638 T A 7: 103,999,184 probably null Het
Phf20l1 T A 15: 66,609,547 V264D probably damaging Het
Pigs A G 11: 78,339,364 Y319C probably damaging Het
Pkd2l2 T C 18: 34,438,771 Y608H probably damaging Het
Ppard G T 17: 28,297,119 E106* probably null Het
Pramef25 A G 4: 143,949,692 S281P probably benign Het
Pramef6 C T 4: 143,895,373 V471I possibly damaging Het
Psenen T C 7: 30,562,348 T48A probably benign Het
Ralgps2 A T 1: 156,824,050 probably null Het
Ripk4 T A 16: 97,745,905 R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Scgb2b24 T A 7: 33,738,477 E68D probably damaging Het
Setx A G 2: 29,173,694 D2334G possibly damaging Het
Sh3bp4 A G 1: 89,144,921 D497G possibly damaging Het
Smarca2 A T 19: 26,679,173 I850F possibly damaging Het
Spidr T A 16: 15,912,516 probably null Het
Srms T C 2: 181,212,657 D39G probably benign Het
Trpc2 T A 7: 102,090,006 I528N probably damaging Het
Tshr A G 12: 91,538,360 I691V probably benign Het
Urb1 A C 16: 90,787,414 V560G probably benign Het
Usp37 A G 1: 74,495,782 S2P possibly damaging Het
Vmn1r60 G A 7: 5,544,600 S167F probably benign Het
Vmn2r89 G A 14: 51,455,993 V267I probably damaging Het
Washc3 T A 10: 88,213,706 D63E probably benign Het
Wdr89 A G 12: 75,633,385 S32P probably damaging Het
Zfp157 T C 5: 138,457,051 S504P possibly damaging Het
Other mutations in Smyd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02869:Smyd1 APN 6 71221023 unclassified probably benign
IGL02901:Smyd1 APN 6 71238630 missense probably benign 0.00
PIT4498001:Smyd1 UTSW 6 71219288 missense probably benign 0.00
R0134:Smyd1 UTSW 6 71216765 missense probably damaging 1.00
R1344:Smyd1 UTSW 6 71262167 missense probably benign 0.36
R1418:Smyd1 UTSW 6 71262167 missense probably benign 0.36
R1737:Smyd1 UTSW 6 71216891 missense probably damaging 1.00
R1909:Smyd1 UTSW 6 71239579 missense probably benign 0.34
R1978:Smyd1 UTSW 6 71312719 splice site probably null
R2281:Smyd1 UTSW 6 71238676 missense probably damaging 0.99
R2418:Smyd1 UTSW 6 71239553 missense probably damaging 1.00
R4914:Smyd1 UTSW 6 71219337 missense probably benign 0.00
R5395:Smyd1 UTSW 6 71219390 missense possibly damaging 0.95
R5589:Smyd1 UTSW 6 71262180 missense probably damaging 1.00
R5663:Smyd1 UTSW 6 71239721 missense probably benign
R7014:Smyd1 UTSW 6 71238627 missense probably damaging 1.00
R7074:Smyd1 UTSW 6 71237375 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGACTGGCTTCTTCAGACATCC -3'
(R):5'- GGAAGCCCTGGAGAATGCTAATC -3'

Sequencing Primer
(F):5'- TCTTCAGACATCCCCAGGTCAG -3'
(R):5'- CTGGAGAATGCTAATCGGCCG -3'
Posted On2018-06-22