Mutagenetix > Incidental Mutations

Incidental Mutation 'R6572:Eml2'

526274

Institutional Source

Beutler Lab

Gene Symbol

Eml2

Ensembl Gene

ENSMUSG00000040811

Gene Name

echinoderm microtubule associated protein like 2

Synonyms

1600029N02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6572 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19176421-19206482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19196614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 373 (V373A)

Ref Sequence

ENSEMBL: ENSMUSP00000112447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]

AlphaFold

Q7TNG5

Predicted Effect

probably benign
Transcript: ENSMUST00000048502
AA Change: V392A

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: V392A

Domain	Start	End	E-Value	Type
Pfam:HELP	17	65	4.6e-14	PFAM
WD40	113	162	8.36e-2	SMART
WD40	165	210	9.21e0	SMART
WD40	213	252	7.99e-1	SMART
WD40	258	298	3.7e0	SMART
WD40	301	341	3.58e-1	SMART
WD40	385	424	5.52e-2	SMART
WD40	427	465	1.1e1	SMART
WD40	468	507	4.95e-4	SMART
WD40	514	553	4.62e-4	SMART
WD40	579	620	4.75e1	SMART
WD40	626	666	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117338
AA Change: V565A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: V565A

Domain	Start	End	E-Value	Type
low complexity region	2	32	N/A	INTRINSIC
coiled coil region	59	106	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
Pfam:HELP	211	285	3.5e-29	PFAM
WD40	286	335	5.5e-4	SMART
WD40	338	383	5.8e-2	SMART
WD40	386	425	5.2e-3	SMART
WD40	431	471	2.4e-2	SMART
WD40	474	514	2.3e-3	SMART
WD40	558	597	3.6e-4	SMART
WD40	600	638	7.1e-2	SMART
WD40	641	680	3.1e-6	SMART
WD40	687	726	3.1e-6	SMART
WD40	752	793	3e-1	SMART
WD40	799	839	1.7e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120595
AA Change: V373A

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: V373A

Domain	Start	End	E-Value	Type
WD40	94	154	2.48e0	SMART
WD40	157	196	7.99e-1	SMART
WD40	202	242	3.7e0	SMART
WD40	245	285	3.58e-1	SMART
WD40	329	368	5.52e-2	SMART
WD40	371	409	1.1e1	SMART
WD40	412	451	4.95e-4	SMART
WD40	458	497	4.62e-4	SMART
WD40	523	564	4.75e1	SMART
WD40	570	610	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148246
AA Change: V373A

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811
AA Change: V373A

Domain	Start	End	E-Value	Type
WD40	94	143	8.36e-2	SMART
WD40	146	191	9.21e0	SMART
WD40	194	233	7.99e-1	SMART
WD40	239	279	3.7e0	SMART
WD40	282	322	3.58e-1	SMART
WD40	366	405	5.52e-2	SMART

Meta Mutation Damage Score

0.2476

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (62/64)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	C	T	15: 37,425,717	Q34*	probably null	Het
Adamts3	T	A	5: 89,861,609	H65L	possibly damaging	Het
Ago2	A	G	15: 73,126,977	V257A	probably benign	Het
Ahnak	A	G	19: 9,007,976	K2208R	probably damaging	Het
Apc2	C	T	10: 80,311,779	S860L	probably damaging	Het
Arhgap18	A	G	10: 26,846,416		probably null	Het
Arhgap33	T	C	7: 30,527,210	E524G	probably damaging	Het
Ascc3	C	T	10: 50,690,247	Q763*	probably null	Het
Atg2a	T	C	19: 6,254,665	L1184P	probably damaging	Het
Baiap2l1	A	G	5: 144,286,302	L75P	probably damaging	Het
Btbd17	A	T	11: 114,792,220	L222Q	probably damaging	Het
Chst13	G	T	6: 90,309,606	R125S	probably benign	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Cracr2a	T	C	6: 127,608,752		probably null	Het
Dchs1	T	A	7: 105,758,806	T1940S	possibly damaging	Het
Ddit4l	G	T	3: 137,626,350	R159L	probably benign	Het
Dock3	A	G	9: 106,989,475	Y679H	probably damaging	Het
Dyrk4	T	G	6: 126,897,238	I130L	probably benign	Het
Ephb1	A	G	9: 102,066,898	F312L	probably benign	Het
Fam189a2	A	T	19: 23,984,718	M307K	possibly damaging	Het
Fndc9	A	T	11: 46,237,881	I76F	probably damaging	Het
Frk	G	A	10: 34,583,967	R186K	probably benign	Het
Gpatch3	G	T	4: 133,574,880	G41C	probably damaging	Het
Greb1l	T	A	18: 10,522,131	H633Q	probably benign	Het
Gstt4	T	A	10: 75,815,120	T223S	probably damaging	Het
Hpd	C	T	5: 123,180,676	E60K	probably benign	Het
Inpp5d	C	T	1: 87,695,396	P403S	probably damaging	Het
Klk1b9	T	A	7: 43,979,735	I189K	probably benign	Het
Kmt2e	A	T	5: 23,497,581	H239L	possibly damaging	Het
Lrriq3	A	G	3: 155,181,675	D344G	probably benign	Het
Neb	A	G	2: 52,278,847	I1892T	probably damaging	Het
Neto2	A	T	8: 85,670,404	I73N	possibly damaging	Het
Nipal3	A	T	4: 135,447,253	S396T	probably benign	Het
Olfr395	A	G	11: 73,906,803	S230P	possibly damaging	Het
Olfr638	T	A	7: 103,999,184		probably null	Het
Phf20l1	T	A	15: 66,609,547	V264D	probably damaging	Het
Pigs	A	G	11: 78,339,364	Y319C	probably damaging	Het
Pkd2l2	T	C	18: 34,438,771	Y608H	probably damaging	Het
Ppard	G	T	17: 28,297,119	E106*	probably null	Het
Pramef25	A	G	4: 143,949,692	S281P	probably benign	Het
Pramef6	C	T	4: 143,895,373	V471I	possibly damaging	Het
Psenen	T	C	7: 30,562,348	T48A	probably benign	Het
Ralgps2	A	T	1: 156,824,050		probably null	Het
Ripk4	T	A	16: 97,745,905	R323*	probably null	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Scgb2b24	T	A	7: 33,738,477	E68D	probably damaging	Het
Setx	A	G	2: 29,173,694	D2334G	possibly damaging	Het
Sh3bp4	A	G	1: 89,144,921	D497G	possibly damaging	Het
Smarca2	A	T	19: 26,679,173	I850F	possibly damaging	Het
Smyd1	A	G	6: 71,225,412	Y270H	probably damaging	Het
Spidr	T	A	16: 15,912,516		probably null	Het
Srms	T	C	2: 181,212,657	D39G	probably benign	Het
Trpc2	T	A	7: 102,090,006	I528N	probably damaging	Het
Tshr	A	G	12: 91,538,360	I691V	probably benign	Het
Urb1	A	C	16: 90,787,414	V560G	probably benign	Het
Usp37	A	G	1: 74,495,782	S2P	possibly damaging	Het
Vmn1r60	G	A	7: 5,544,600	S167F	probably benign	Het
Vmn2r89	G	A	14: 51,455,993	V267I	probably damaging	Het
Washc3	T	A	10: 88,213,706	D63E	probably benign	Het
Wdr89	A	G	12: 75,633,385	S32P	probably damaging	Het
Zfp157	T	C	5: 138,457,051	S504P	possibly damaging	Het

Other mutations in Eml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00690:Eml2	APN	7	19206143	missense	probably damaging	1.00
IGL00786:Eml2	APN	7	19202582	missense	probably damaging	1.00
IGL01084:Eml2	APN	7	19190738	nonsense	probably null
IGL01132:Eml2	APN	7	19200539	missense	probably damaging	1.00
IGL01678:Eml2	APN	7	19186122	missense	probably benign	0.38
IGL01800:Eml2	APN	7	19201197	intron	probably benign
IGL02517:Eml2	APN	7	19206130	missense	probably damaging	1.00
IGL02607:Eml2	APN	7	19206111	missense	probably damaging	1.00
IGL02676:Eml2	APN	7	19184921	nonsense	probably null
IGL03082:Eml2	APN	7	19201877	missense	probably damaging	1.00
puffery	UTSW	7	19201163	missense	probably damaging	1.00
R0628_Eml2_697	UTSW	7	19201554	splice site	probably benign
R0040:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R0135:Eml2	UTSW	7	19203952	missense	probably damaging	1.00
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0362:Eml2	UTSW	7	19190806	splice site	probably null
R0387:Eml2	UTSW	7	19182259	splice site	probably null
R0432:Eml2	UTSW	7	19179531	nonsense	probably null
R0614:Eml2	UTSW	7	19202591	missense	probably damaging	1.00
R0628:Eml2	UTSW	7	19201554	splice site	probably benign
R1078:Eml2	UTSW	7	19179762	missense	probably benign	0.24
R1531:Eml2	UTSW	7	19196254	missense	probably damaging	1.00
R1856:Eml2	UTSW	7	19194061	missense	probably damaging	0.97
R1864:Eml2	UTSW	7	19201878	missense	probably damaging	1.00
R1937:Eml2	UTSW	7	19203964	missense	possibly damaging	0.68
R2032:Eml2	UTSW	7	19202555	missense	probably benign	0.03
R2185:Eml2	UTSW	7	19194028	missense	probably damaging	1.00
R2419:Eml2	UTSW	7	19176695	unclassified	probably benign
R3821:Eml2	UTSW	7	19202986	missense	possibly damaging	0.94
R4199:Eml2	UTSW	7	19179439	missense	probably benign	0.00
R4411:Eml2	UTSW	7	19182401	critical splice donor site	probably null
R4497:Eml2	UTSW	7	19179350	missense	probably damaging	1.00
R4885:Eml2	UTSW	7	19204010	missense	probably benign	0.05
R4912:Eml2	UTSW	7	19193999	splice site	probably null
R5028:Eml2	UTSW	7	19179447	critical splice donor site	probably null
R5192:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5196:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5373:Eml2	UTSW	7	19179263	missense	possibly damaging	0.92
R5718:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5719:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5720:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5727:Eml2	UTSW	7	19190760	missense	probably damaging	0.99
R5841:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5842:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5843:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5844:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6014:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6015:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6017:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6073:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6075:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6126:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6128:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6129:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6189:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6190:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6258:Eml2	UTSW	7	19179364	splice site	probably null
R6273:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6289:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6376:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6378:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6381:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6384:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6394:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6435:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6436:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6437:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6476:Eml2	UTSW	7	19196311	missense	probably benign	0.26
R6550:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6551:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6552:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6554:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6598:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6599:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6704:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6705:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6709:Eml2	UTSW	7	19206211	makesense	probably null
R6730:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6734:Eml2	UTSW	7	19200507	missense	probably benign	0.35
R6742:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6769:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6770:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6864:Eml2	UTSW	7	19196281	missense	probably damaging	0.99
R6878:Eml2	UTSW	7	19200612	missense	probably benign	0.08
R7045:Eml2	UTSW	7	19201579	missense	probably damaging	1.00
R7260:Eml2	UTSW	7	19200590	missense	probably benign	0.45
R7478:Eml2	UTSW	7	19206141	nonsense	probably null
R7706:Eml2	UTSW	7	19186110	missense	possibly damaging	0.79
R7811:Eml2	UTSW	7	19186122	missense	probably benign	0.38
R8084:Eml2	UTSW	7	19181224	critical splice donor site	probably null
R8337:Eml2	UTSW	7	19196236	missense	possibly damaging	0.84
R8414:Eml2	UTSW	7	19179295	missense	probably damaging	1.00
R8868:Eml2	UTSW	7	19194063	missense	probably benign	0.03
R8934:Eml2	UTSW	7	19179813	missense	probably damaging	0.99
R9110:Eml2	UTSW	7	19191695	missense	probably benign	0.07
R9131:Eml2	UTSW	7	19184826	missense
R9144:Eml2	UTSW	7	19201639	missense	possibly damaging	0.75
R9261:Eml2	UTSW	7	19179818	missense	probably benign	0.45
R9285:Eml2	UTSW	7	19191643	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATGGCCCTGTAGAATCCTGG -3'
(R):5'- TTCCCAGGCCAGGAAGAAAG -3'

Sequencing Primer
(F):5'- TACGGGGCTCCTAACTCTG -3'
(R):5'- CCAGGCCAGGAAGAAAGGGATG -3'

Posted On

2018-06-22