Incidental Mutation 'R6572:Scgb2b24'
ID526277
Institutional Source Beutler Lab
Gene Symbol Scgb2b24
Ensembl Gene ENSMUSG00000046438
Gene Namesecretoglobin, family 2B, member 24
SynonymsC2b, Abpbg24, Abpz, Scgb2b3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6572 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location33737190-33739312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33738477 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 68 (E68D)
Ref Sequence ENSEMBL: ENSMUSP00000052456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055444]
Predicted Effect probably damaging
Transcript: ENSMUST00000055444
AA Change: E68D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052456
Gene: ENSMUSG00000046438
AA Change: E68D

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
Pfam:Feld-I_B 24 90 5.9e-33 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,717 Q34* probably null Het
Adamts3 T A 5: 89,861,609 H65L possibly damaging Het
Ago2 A G 15: 73,126,977 V257A probably benign Het
Ahnak A G 19: 9,007,976 K2208R probably damaging Het
Apc2 C T 10: 80,311,779 S860L probably damaging Het
Arhgap18 A G 10: 26,846,416 probably null Het
Arhgap33 T C 7: 30,527,210 E524G probably damaging Het
Ascc3 C T 10: 50,690,247 Q763* probably null Het
Atg2a T C 19: 6,254,665 L1184P probably damaging Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Btbd17 A T 11: 114,792,220 L222Q probably damaging Het
Chst13 G T 6: 90,309,606 R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Cracr2a T C 6: 127,608,752 probably null Het
Dchs1 T A 7: 105,758,806 T1940S possibly damaging Het
Ddit4l G T 3: 137,626,350 R159L probably benign Het
Dock3 A G 9: 106,989,475 Y679H probably damaging Het
Dyrk4 T G 6: 126,897,238 I130L probably benign Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Ephb1 A G 9: 102,066,898 F312L probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Fndc9 A T 11: 46,237,881 I76F probably damaging Het
Frk G A 10: 34,583,967 R186K probably benign Het
Gpatch3 G T 4: 133,574,880 G41C probably damaging Het
Greb1l T A 18: 10,522,131 H633Q probably benign Het
Gstt4 T A 10: 75,815,120 T223S probably damaging Het
Hpd C T 5: 123,180,676 E60K probably benign Het
Inpp5d C T 1: 87,695,396 P403S probably damaging Het
Klk1b9 T A 7: 43,979,735 I189K probably benign Het
Kmt2e A T 5: 23,497,581 H239L possibly damaging Het
Lrriq3 A G 3: 155,181,675 D344G probably benign Het
Neb A G 2: 52,278,847 I1892T probably damaging Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nipal3 A T 4: 135,447,253 S396T probably benign Het
Olfr395 A G 11: 73,906,803 S230P possibly damaging Het
Olfr638 T A 7: 103,999,184 probably null Het
Phf20l1 T A 15: 66,609,547 V264D probably damaging Het
Pigs A G 11: 78,339,364 Y319C probably damaging Het
Pkd2l2 T C 18: 34,438,771 Y608H probably damaging Het
Ppard G T 17: 28,297,119 E106* probably null Het
Pramef25 A G 4: 143,949,692 S281P probably benign Het
Pramef6 C T 4: 143,895,373 V471I possibly damaging Het
Psenen T C 7: 30,562,348 T48A probably benign Het
Ralgps2 A T 1: 156,824,050 probably null Het
Ripk4 T A 16: 97,745,905 R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setx A G 2: 29,173,694 D2334G possibly damaging Het
Sh3bp4 A G 1: 89,144,921 D497G possibly damaging Het
Smarca2 A T 19: 26,679,173 I850F possibly damaging Het
Smyd1 A G 6: 71,225,412 Y270H probably damaging Het
Spidr T A 16: 15,912,516 probably null Het
Srms T C 2: 181,212,657 D39G probably benign Het
Trpc2 T A 7: 102,090,006 I528N probably damaging Het
Tshr A G 12: 91,538,360 I691V probably benign Het
Urb1 A C 16: 90,787,414 V560G probably benign Het
Usp37 A G 1: 74,495,782 S2P possibly damaging Het
Vmn1r60 G A 7: 5,544,600 S167F probably benign Het
Vmn2r89 G A 14: 51,455,993 V267I probably damaging Het
Washc3 T A 10: 88,213,706 D63E probably benign Het
Wdr89 A G 12: 75,633,385 S32P probably damaging Het
Zfp157 T C 5: 138,457,051 S504P possibly damaging Het
Other mutations in Scgb2b24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Scgb2b24 APN 7 33739227 missense probably damaging 0.97
IGL02328:Scgb2b24 APN 7 33738625 splice site probably benign
PIT4618001:Scgb2b24 UTSW 7 33738611 missense probably damaging 0.96
R3441:Scgb2b24 UTSW 7 33738600 missense probably damaging 1.00
R5874:Scgb2b24 UTSW 7 33737405 missense probably damaging 0.99
R6800:Scgb2b24 UTSW 7 33738469 missense probably benign 0.01
R7431:Scgb2b24 UTSW 7 33739249 missense probably benign 0.13
R8096:Scgb2b24 UTSW 7 33739221 splice site probably null
R8458:Scgb2b24 UTSW 7 33737354 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTGTACCTGGCATGCTCC -3'
(R):5'- CGAGCTTCTGTGTCTACCAG -3'

Sequencing Primer
(F):5'- GGCATGCTCCATTGACATG -3'
(R):5'- ACCAGCCTGTTGTCTTTTAACGATG -3'
Posted On2018-06-22