Incidental Mutation 'R6572:Wdr89'
ID 526293
Institutional Source Beutler Lab
Gene Symbol Wdr89
Ensembl Gene ENSMUSG00000045690
Gene Name WD repeat domain 89
Synonyms 2600001A11Rik
MMRRC Submission 044696-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6572 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 75677370-75716311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75680159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 32 (S32P)
Ref Sequence ENSEMBL: ENSMUSP00000140172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062370] [ENSMUST00000187307]
AlphaFold Q9D0R9
Predicted Effect probably damaging
Transcript: ENSMUST00000062370
AA Change: S32P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050532
Gene: ENSMUSG00000045690
AA Change: S32P

DomainStartEndE-ValueType
WD40 20 56 3.82e1 SMART
WD40 59 98 1.85e-3 SMART
WD40 103 147 2.64e2 SMART
WD40 157 198 6.38e-7 SMART
WD40 205 244 1.1e2 SMART
WD40 308 348 1.82e-2 SMART
low complexity region 366 379 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187307
AA Change: S32P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140172
Gene: ENSMUSG00000045690
AA Change: S32P

DomainStartEndE-ValueType
WD40 20 56 3.82e1 SMART
WD40 59 98 1.85e-3 SMART
WD40 103 147 2.64e2 SMART
WD40 157 198 6.38e-7 SMART
WD40 205 244 1.1e2 SMART
WD40 308 348 1.82e-2 SMART
low complexity region 366 379 N/A INTRINSIC
Meta Mutation Damage Score 0.4823 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,961 (GRCm39) Q34* probably null Het
Adamts3 T A 5: 90,009,468 (GRCm39) H65L possibly damaging Het
Ago2 A G 15: 72,998,826 (GRCm39) V257A probably benign Het
Ahnak A G 19: 8,985,340 (GRCm39) K2208R probably damaging Het
Apc2 C T 10: 80,147,613 (GRCm39) S860L probably damaging Het
Arhgap18 A G 10: 26,722,412 (GRCm39) probably null Het
Arhgap33 T C 7: 30,226,635 (GRCm39) E524G probably damaging Het
Ascc3 C T 10: 50,566,343 (GRCm39) Q763* probably null Het
Atg2a T C 19: 6,304,695 (GRCm39) L1184P probably damaging Het
Baiap2l1 A G 5: 144,223,112 (GRCm39) L75P probably damaging Het
Btbd17 A T 11: 114,683,046 (GRCm39) L222Q probably damaging Het
Chst13 G T 6: 90,286,588 (GRCm39) R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,481,655 (GRCm39) probably null Het
Cracr2a T C 6: 127,585,715 (GRCm39) probably null Het
Dchs1 T A 7: 105,408,013 (GRCm39) T1940S possibly damaging Het
Ddit4l G T 3: 137,332,111 (GRCm39) R159L probably benign Het
Dock3 A G 9: 106,866,674 (GRCm39) Y679H probably damaging Het
Dyrk4 T G 6: 126,874,201 (GRCm39) I130L probably benign Het
Eml2 T C 7: 18,930,539 (GRCm39) V373A possibly damaging Het
Entrep1 A T 19: 23,962,082 (GRCm39) M307K possibly damaging Het
Ephb1 A G 9: 101,944,097 (GRCm39) F312L probably benign Het
Fndc9 A T 11: 46,128,708 (GRCm39) I76F probably damaging Het
Frk G A 10: 34,459,963 (GRCm39) R186K probably benign Het
Gpatch3 G T 4: 133,302,191 (GRCm39) G41C probably damaging Het
Greb1l T A 18: 10,522,131 (GRCm39) H633Q probably benign Het
Gstt4 T A 10: 75,650,954 (GRCm39) T223S probably damaging Het
Hpd C T 5: 123,318,739 (GRCm39) E60K probably benign Het
Inpp5d C T 1: 87,623,118 (GRCm39) P403S probably damaging Het
Klk1b9 T A 7: 43,629,159 (GRCm39) I189K probably benign Het
Kmt2e A T 5: 23,702,579 (GRCm39) H239L possibly damaging Het
Lrriq3 A G 3: 154,887,312 (GRCm39) D344G probably benign Het
Neb A G 2: 52,168,859 (GRCm39) I1892T probably damaging Het
Neto2 A T 8: 86,397,033 (GRCm39) I73N possibly damaging Het
Nipal3 A T 4: 135,174,564 (GRCm39) S396T probably benign Het
Or1e35 A G 11: 73,797,629 (GRCm39) S230P possibly damaging Het
Or51q1c T A 7: 103,648,391 (GRCm39) probably null Het
Phf20l1 T A 15: 66,481,396 (GRCm39) V264D probably damaging Het
Pigs A G 11: 78,230,190 (GRCm39) Y319C probably damaging Het
Pkd2l2 T C 18: 34,571,824 (GRCm39) Y608H probably damaging Het
Ppard G T 17: 28,516,093 (GRCm39) E106* probably null Het
Pramel11 C T 4: 143,621,943 (GRCm39) V471I possibly damaging Het
Pramel16 A G 4: 143,676,262 (GRCm39) S281P probably benign Het
Psenen T C 7: 30,261,773 (GRCm39) T48A probably benign Het
Ralgps2 A T 1: 156,651,620 (GRCm39) probably null Het
Ripk4 T A 16: 97,547,105 (GRCm39) R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Scgb2b24 T A 7: 33,437,902 (GRCm39) E68D probably damaging Het
Setx A G 2: 29,063,706 (GRCm39) D2334G possibly damaging Het
Sh3bp4 A G 1: 89,072,643 (GRCm39) D497G possibly damaging Het
Smarca2 A T 19: 26,656,573 (GRCm39) I850F possibly damaging Het
Smyd1 A G 6: 71,202,396 (GRCm39) Y270H probably damaging Het
Spidr T A 16: 15,730,380 (GRCm39) probably null Het
Srms T C 2: 180,854,450 (GRCm39) D39G probably benign Het
Trpc2 T A 7: 101,739,213 (GRCm39) I528N probably damaging Het
Tshr A G 12: 91,505,134 (GRCm39) I691V probably benign Het
Urb1 A C 16: 90,584,302 (GRCm39) V560G probably benign Het
Usp37 A G 1: 74,534,941 (GRCm39) S2P possibly damaging Het
Vmn1r60 G A 7: 5,547,599 (GRCm39) S167F probably benign Het
Vmn2r89 G A 14: 51,693,450 (GRCm39) V267I probably damaging Het
Washc3 T A 10: 88,049,568 (GRCm39) D63E probably benign Het
Zfp157 T C 5: 138,455,313 (GRCm39) S504P possibly damaging Het
Other mutations in Wdr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Wdr89 APN 12 75,679,825 (GRCm39) nonsense probably null
IGL02176:Wdr89 APN 12 75,679,897 (GRCm39) missense probably damaging 0.96
IGL02472:Wdr89 APN 12 75,679,743 (GRCm39) missense probably damaging 1.00
IGL02973:Wdr89 APN 12 75,679,873 (GRCm39) missense probably damaging 0.98
R0003:Wdr89 UTSW 12 75,679,367 (GRCm39) missense probably benign 0.00
R2060:Wdr89 UTSW 12 75,679,762 (GRCm39) missense probably damaging 1.00
R4494:Wdr89 UTSW 12 75,679,521 (GRCm39) missense probably damaging 1.00
R5120:Wdr89 UTSW 12 75,679,412 (GRCm39) missense probably damaging 1.00
R5195:Wdr89 UTSW 12 75,680,062 (GRCm39) missense probably benign 0.23
R7487:Wdr89 UTSW 12 75,679,388 (GRCm39) missense probably benign
R7835:Wdr89 UTSW 12 75,679,673 (GRCm39) missense probably damaging 1.00
R8445:Wdr89 UTSW 12 75,679,636 (GRCm39) missense probably damaging 0.99
R8765:Wdr89 UTSW 12 75,679,688 (GRCm39) missense probably damaging 1.00
R9202:Wdr89 UTSW 12 75,679,943 (GRCm39) missense probably benign 0.00
R9269:Wdr89 UTSW 12 75,679,564 (GRCm39) missense possibly damaging 0.50
R9340:Wdr89 UTSW 12 75,679,937 (GRCm39) missense probably benign 0.11
R9522:Wdr89 UTSW 12 75,679,924 (GRCm39) missense probably damaging 1.00
R9557:Wdr89 UTSW 12 75,679,666 (GRCm39) missense probably damaging 1.00
R9760:Wdr89 UTSW 12 75,680,026 (GRCm39) missense probably damaging 0.99
X0023:Wdr89 UTSW 12 75,679,951 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACAGGCTTTTCGCTAG -3'
(R):5'- ACATGCGCTTTCTGAGAAGTTC -3'

Sequencing Primer
(F):5'- AACACTTCACGGTGCCATCTG -3'
(R):5'- TGAGGACCAGTTTGCTAG -3'
Posted On 2018-06-22