Incidental Mutation 'R6572:Phf20l1'
ID526297
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene NamePHD finger protein 20-like 1
SynonymsCGI-72, E130113K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R6572 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location66577560-66647976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66609547 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 264 (V264D)
Ref Sequence ENSEMBL: ENSMUSP00000155465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]
Predicted Effect probably damaging
Transcript: ENSMUST00000048188
AA Change: V291D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: V291D

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229160
AA Change: V290D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229486
Predicted Effect probably damaging
Transcript: ENSMUST00000229576
AA Change: V291D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230584
Predicted Effect probably damaging
Transcript: ENSMUST00000230882
AA Change: V290D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230915
Predicted Effect probably damaging
Transcript: ENSMUST00000230948
AA Change: V264D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,717 Q34* probably null Het
Adamts3 T A 5: 89,861,609 H65L possibly damaging Het
Ago2 A G 15: 73,126,977 V257A probably benign Het
Ahnak A G 19: 9,007,976 K2208R probably damaging Het
Apc2 C T 10: 80,311,779 S860L probably damaging Het
Arhgap18 A G 10: 26,846,416 probably null Het
Arhgap33 T C 7: 30,527,210 E524G probably damaging Het
Ascc3 C T 10: 50,690,247 Q763* probably null Het
Atg2a T C 19: 6,254,665 L1184P probably damaging Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Btbd17 A T 11: 114,792,220 L222Q probably damaging Het
Chst13 G T 6: 90,309,606 R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Cracr2a T C 6: 127,608,752 probably null Het
Dchs1 T A 7: 105,758,806 T1940S possibly damaging Het
Ddit4l G T 3: 137,626,350 R159L probably benign Het
Dock3 A G 9: 106,989,475 Y679H probably damaging Het
Dyrk4 T G 6: 126,897,238 I130L probably benign Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Ephb1 A G 9: 102,066,898 F312L probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Fndc9 A T 11: 46,237,881 I76F probably damaging Het
Frk G A 10: 34,583,967 R186K probably benign Het
Gpatch3 G T 4: 133,574,880 G41C probably damaging Het
Greb1l T A 18: 10,522,131 H633Q probably benign Het
Gstt4 T A 10: 75,815,120 T223S probably damaging Het
Hpd C T 5: 123,180,676 E60K probably benign Het
Inpp5d C T 1: 87,695,396 P403S probably damaging Het
Klk1b9 T A 7: 43,979,735 I189K probably benign Het
Kmt2e A T 5: 23,497,581 H239L possibly damaging Het
Lrriq3 A G 3: 155,181,675 D344G probably benign Het
Neb A G 2: 52,278,847 I1892T probably damaging Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nipal3 A T 4: 135,447,253 S396T probably benign Het
Olfr395 A G 11: 73,906,803 S230P possibly damaging Het
Olfr638 T A 7: 103,999,184 probably null Het
Pigs A G 11: 78,339,364 Y319C probably damaging Het
Pkd2l2 T C 18: 34,438,771 Y608H probably damaging Het
Ppard G T 17: 28,297,119 E106* probably null Het
Pramef25 A G 4: 143,949,692 S281P probably benign Het
Pramef6 C T 4: 143,895,373 V471I possibly damaging Het
Psenen T C 7: 30,562,348 T48A probably benign Het
Ralgps2 A T 1: 156,824,050 probably null Het
Ripk4 T A 16: 97,745,905 R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Scgb2b24 T A 7: 33,738,477 E68D probably damaging Het
Setx A G 2: 29,173,694 D2334G possibly damaging Het
Sh3bp4 A G 1: 89,144,921 D497G possibly damaging Het
Smarca2 A T 19: 26,679,173 I850F possibly damaging Het
Smyd1 A G 6: 71,225,412 Y270H probably damaging Het
Spidr T A 16: 15,912,516 probably null Het
Srms T C 2: 181,212,657 D39G probably benign Het
Trpc2 T A 7: 102,090,006 I528N probably damaging Het
Tshr A G 12: 91,538,360 I691V probably benign Het
Urb1 A C 16: 90,787,414 V560G probably benign Het
Usp37 A G 1: 74,495,782 S2P possibly damaging Het
Vmn1r60 G A 7: 5,544,600 S167F probably benign Het
Vmn2r89 G A 14: 51,455,993 V267I probably damaging Het
Washc3 T A 10: 88,213,706 D63E probably benign Het
Wdr89 A G 12: 75,633,385 S32P probably damaging Het
Zfp157 T C 5: 138,457,051 S504P possibly damaging Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66629035 missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66615633 splice site probably benign
IGL00668:Phf20l1 APN 15 66632849 missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66636832 missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66641908 missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66613132 missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66597691 missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66628991 missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66640025 missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66615410 critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66641801 missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66615632 splice site probably benign
IGL02656:Phf20l1 APN 15 66629827 missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66604864 missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66594980 critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66595151 missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66594884 missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66641947 utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66597403 missense probably damaging 1.00
Abbreviated UTSW 15 66632903 critical splice donor site probably null
curt UTSW 15 66639948 missense possibly damaging 0.90
shorthand UTSW 15 66609547 missense probably damaging 1.00
PIT4305001:Phf20l1 UTSW 15 66613052 missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66609604 missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66595122 missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66615630 splice site probably benign
R1458:Phf20l1 UTSW 15 66604813 missense probably damaging 1.00
R1619:Phf20l1 UTSW 15 66615259 missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66632825 missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66594920 missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66641816 missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66604837 missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66615222 missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66597367 missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66604855 missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66636913 missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66615785 missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66636820 missense possibly damaging 0.85
R6126:Phf20l1 UTSW 15 66636824 missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66632903 critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66629824 missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66630913 missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66604840 missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66604789 missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66597750 missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66636884 missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66604084 missense probably benign 0.02
R7863:Phf20l1 UTSW 15 66615235 missense possibly damaging 0.94
R7991:Phf20l1 UTSW 15 66630919 missense possibly damaging 0.64
R8015:Phf20l1 UTSW 15 66639948 missense possibly damaging 0.90
R8161:Phf20l1 UTSW 15 66604073 missense probably damaging 1.00
R8228:Phf20l1 UTSW 15 66639940 missense possibly damaging 0.81
X0065:Phf20l1 UTSW 15 66597678 missense probably damaging 0.99
X0065:Phf20l1 UTSW 15 66629806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCAGAATGATATGCTACTCTAC -3'
(R):5'- TGAGTCAGTGCTCTATCCCCATATC -3'

Sequencing Primer
(F):5'- CATCTTAATCTAGACTTTGAAGCCAG -3'
(R):5'- TATCCCCATATCTGATCAGAGGG -3'
Posted On2018-06-22