Incidental Mutation 'R6572:Ppard'
ID526302
Institutional Source Beutler Lab
Gene Symbol Ppard
Ensembl Gene ENSMUSG00000002250
Gene Nameperoxisome proliferator activator receptor delta
SynonymsNr1c2, Pparb/d, PPAR-delta, Peroxisome proliferator-activated receptor beta, Pparb, NUC1, PPARdelta/beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R6572 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28232754-28301469 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 28297119 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 106 (E106*)
Ref Sequence ENSEMBL: ENSMUSP00000133077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002320] [ENSMUST00000169040]
Predicted Effect probably null
Transcript: ENSMUST00000002320
AA Change: E106*
SMART Domains Protein: ENSMUSP00000002320
Gene: ENSMUSG00000002250
AA Change: E106*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Blast:HOLI 183 208 1e-6 BLAST
HOLI 250 409 1.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166744
Predicted Effect probably null
Transcript: ENSMUST00000169040
AA Change: E106*
SMART Domains Protein: ENSMUSP00000133077
Gene: ENSMUSG00000002250
AA Change: E106*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) family. PPARs are nuclear hormone receptors that bind peroxisome proliferators and control the size and number of peroxisomes produced by cells. PPARs mediate a variety of biological processes, and may be involved in the development of several chronic diseases, including diabetes, obesity, atherosclerosis, and cancer. This protein is a potent inhibitor of ligand-induced transcription activity of PPAR alpha and PPAR gamma. It may function as an integrator of transcription repression and nuclear receptor signaling. The expression of this gene is found to be elevated in colorectal cancer cells. The elevated expression can be repressed by adenomatosis polyposis coli (APC), a tumor suppressor protein related to APC/beta-catenin signaling pathway. Knockout studies in mice suggested the role of this protein in myelination of the corpus callosum, lipid metabolism, and epidermal cell proliferation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a number of different targeted mutations show variable prenatal lethality and a range of phenotypes such as placental, brain, skin, hair follicle, adipose and lipid homeostasis abnormalities, growth retardation, reduced fertility, andincreased incidence of tumors/induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik C T 15: 37,425,717 Q34* probably null Het
Adamts3 T A 5: 89,861,609 H65L possibly damaging Het
Ago2 A G 15: 73,126,977 V257A probably benign Het
Ahnak A G 19: 9,007,976 K2208R probably damaging Het
Apc2 C T 10: 80,311,779 S860L probably damaging Het
Arhgap18 A G 10: 26,846,416 probably null Het
Arhgap33 T C 7: 30,527,210 E524G probably damaging Het
Ascc3 C T 10: 50,690,247 Q763* probably null Het
Atg2a T C 19: 6,254,665 L1184P probably damaging Het
Baiap2l1 A G 5: 144,286,302 L75P probably damaging Het
Btbd17 A T 11: 114,792,220 L222Q probably damaging Het
Chst13 G T 6: 90,309,606 R125S probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Cracr2a T C 6: 127,608,752 probably null Het
Dchs1 T A 7: 105,758,806 T1940S possibly damaging Het
Ddit4l G T 3: 137,626,350 R159L probably benign Het
Dock3 A G 9: 106,989,475 Y679H probably damaging Het
Dyrk4 T G 6: 126,897,238 I130L probably benign Het
Eml2 T C 7: 19,196,614 V373A possibly damaging Het
Ephb1 A G 9: 102,066,898 F312L probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Fndc9 A T 11: 46,237,881 I76F probably damaging Het
Frk G A 10: 34,583,967 R186K probably benign Het
Gpatch3 G T 4: 133,574,880 G41C probably damaging Het
Greb1l T A 18: 10,522,131 H633Q probably benign Het
Gstt4 T A 10: 75,815,120 T223S probably damaging Het
Hpd C T 5: 123,180,676 E60K probably benign Het
Inpp5d C T 1: 87,695,396 P403S probably damaging Het
Klk1b9 T A 7: 43,979,735 I189K probably benign Het
Kmt2e A T 5: 23,497,581 H239L possibly damaging Het
Lrriq3 A G 3: 155,181,675 D344G probably benign Het
Neb A G 2: 52,278,847 I1892T probably damaging Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nipal3 A T 4: 135,447,253 S396T probably benign Het
Olfr395 A G 11: 73,906,803 S230P possibly damaging Het
Olfr638 T A 7: 103,999,184 probably null Het
Phf20l1 T A 15: 66,609,547 V264D probably damaging Het
Pigs A G 11: 78,339,364 Y319C probably damaging Het
Pkd2l2 T C 18: 34,438,771 Y608H probably damaging Het
Pramef25 A G 4: 143,949,692 S281P probably benign Het
Pramef6 C T 4: 143,895,373 V471I possibly damaging Het
Psenen T C 7: 30,562,348 T48A probably benign Het
Ralgps2 A T 1: 156,824,050 probably null Het
Ripk4 T A 16: 97,745,905 R323* probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Scgb2b24 T A 7: 33,738,477 E68D probably damaging Het
Setx A G 2: 29,173,694 D2334G possibly damaging Het
Sh3bp4 A G 1: 89,144,921 D497G possibly damaging Het
Smarca2 A T 19: 26,679,173 I850F possibly damaging Het
Smyd1 A G 6: 71,225,412 Y270H probably damaging Het
Spidr T A 16: 15,912,516 probably null Het
Srms T C 2: 181,212,657 D39G probably benign Het
Trpc2 T A 7: 102,090,006 I528N probably damaging Het
Tshr A G 12: 91,538,360 I691V probably benign Het
Urb1 A C 16: 90,787,414 V560G probably benign Het
Usp37 A G 1: 74,495,782 S2P possibly damaging Het
Vmn1r60 G A 7: 5,544,600 S167F probably benign Het
Vmn2r89 G A 14: 51,455,993 V267I probably damaging Het
Washc3 T A 10: 88,213,706 D63E probably benign Het
Wdr89 A G 12: 75,633,385 S32P probably damaging Het
Zfp157 T C 5: 138,457,051 S504P possibly damaging Het
Other mutations in Ppard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Ppard APN 17 28298903 missense probably damaging 1.00
IGL02023:Ppard APN 17 28298897 missense probably benign
IGL03027:Ppard APN 17 28299791 missense possibly damaging 0.68
R1687:Ppard UTSW 17 28297180 missense probably damaging 1.00
R1785:Ppard UTSW 17 28298481 critical splice donor site probably null
R1791:Ppard UTSW 17 28286374 missense unknown
R1832:Ppard UTSW 17 28297110 missense probably benign 0.01
R2062:Ppard UTSW 17 28299689 missense probably damaging 1.00
R4732:Ppard UTSW 17 28286443 missense probably benign
R4733:Ppard UTSW 17 28286443 missense probably benign
R4801:Ppard UTSW 17 28286374 missense unknown
R4802:Ppard UTSW 17 28286374 missense unknown
R4803:Ppard UTSW 17 28286374 missense unknown
R5252:Ppard UTSW 17 28298848 missense probably benign
R5305:Ppard UTSW 17 28298858 missense probably damaging 1.00
R7060:Ppard UTSW 17 28298912 missense probably benign 0.00
R7098:Ppard UTSW 17 28298813 missense possibly damaging 0.94
R7506:Ppard UTSW 17 28298761 missense possibly damaging 0.76
R7599:Ppard UTSW 17 28297117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATTCCCAGTGCCTACATGG -3'
(R):5'- ACAGAATGGGACCCTGGGTTAG -3'

Sequencing Primer
(F):5'- CTACATGGCTGCTCAAAACC -3'
(R):5'- ACCCTGGGTTAGCTGTGC -3'
Posted On2018-06-22