Mutagenetix > Incidental Mutations

Incidental Mutation 'R6572:Greb1l'

526303

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6572 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10522131 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 633 (H633Q)

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: H742Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: H742Q

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532
AA Change: H633Q

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: H633Q

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Meta Mutation Damage Score

0.0801

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

97% (62/64)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447A16Rik	C	T	15: 37,425,717	Q34*	probably null	Het
Adamts3	T	A	5: 89,861,609	H65L	possibly damaging	Het
Ago2	A	G	15: 73,126,977	V257A	probably benign	Het
Ahnak	A	G	19: 9,007,976	K2208R	probably damaging	Het
Apc2	C	T	10: 80,311,779	S860L	probably damaging	Het
Arhgap18	A	G	10: 26,846,416		probably null	Het
Arhgap33	T	C	7: 30,527,210	E524G	probably damaging	Het
Ascc3	C	T	10: 50,690,247	Q763*	probably null	Het
Atg2a	T	C	19: 6,254,665	L1184P	probably damaging	Het
Baiap2l1	A	G	5: 144,286,302	L75P	probably damaging	Het
Btbd17	A	T	11: 114,792,220	L222Q	probably damaging	Het
Chst13	G	T	6: 90,309,606	R125S	probably benign	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Cracr2a	T	C	6: 127,608,752		probably null	Het
Dchs1	T	A	7: 105,758,806	T1940S	possibly damaging	Het
Ddit4l	G	T	3: 137,626,350	R159L	probably benign	Het
Dock3	A	G	9: 106,989,475	Y679H	probably damaging	Het
Dyrk4	T	G	6: 126,897,238	I130L	probably benign	Het
Eml2	T	C	7: 19,196,614	V373A	possibly damaging	Het
Ephb1	A	G	9: 102,066,898	F312L	probably benign	Het
Fam189a2	A	T	19: 23,984,718	M307K	possibly damaging	Het
Fndc9	A	T	11: 46,237,881	I76F	probably damaging	Het
Frk	G	A	10: 34,583,967	R186K	probably benign	Het
Gpatch3	G	T	4: 133,574,880	G41C	probably damaging	Het
Gstt4	T	A	10: 75,815,120	T223S	probably damaging	Het
Hpd	C	T	5: 123,180,676	E60K	probably benign	Het
Inpp5d	C	T	1: 87,695,396	P403S	probably damaging	Het
Klk1b9	T	A	7: 43,979,735	I189K	probably benign	Het
Kmt2e	A	T	5: 23,497,581	H239L	possibly damaging	Het
Lrriq3	A	G	3: 155,181,675	D344G	probably benign	Het
Neb	A	G	2: 52,278,847	I1892T	probably damaging	Het
Neto2	A	T	8: 85,670,404	I73N	possibly damaging	Het
Nipal3	A	T	4: 135,447,253	S396T	probably benign	Het
Olfr395	A	G	11: 73,906,803	S230P	possibly damaging	Het
Olfr638	T	A	7: 103,999,184		probably null	Het
Phf20l1	T	A	15: 66,609,547	V264D	probably damaging	Het
Pigs	A	G	11: 78,339,364	Y319C	probably damaging	Het
Pkd2l2	T	C	18: 34,438,771	Y608H	probably damaging	Het
Ppard	G	T	17: 28,297,119	E106*	probably null	Het
Pramef25	A	G	4: 143,949,692	S281P	probably benign	Het
Pramef6	C	T	4: 143,895,373	V471I	possibly damaging	Het
Psenen	T	C	7: 30,562,348	T48A	probably benign	Het
Ralgps2	A	T	1: 156,824,050		probably null	Het
Ripk4	T	A	16: 97,745,905	R323*	probably null	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Scgb2b24	T	A	7: 33,738,477	E68D	probably damaging	Het
Setx	A	G	2: 29,173,694	D2334G	possibly damaging	Het
Sh3bp4	A	G	1: 89,144,921	D497G	possibly damaging	Het
Smarca2	A	T	19: 26,679,173	I850F	possibly damaging	Het
Smyd1	A	G	6: 71,225,412	Y270H	probably damaging	Het
Spidr	T	A	16: 15,912,516		probably null	Het
Srms	T	C	2: 181,212,657	D39G	probably benign	Het
Trpc2	T	A	7: 102,090,006	I528N	probably damaging	Het
Tshr	A	G	12: 91,538,360	I691V	probably benign	Het
Urb1	A	C	16: 90,787,414	V560G	probably benign	Het
Usp37	A	G	1: 74,495,782	S2P	possibly damaging	Het
Vmn1r60	G	A	7: 5,544,600	S167F	probably benign	Het
Vmn2r89	G	A	14: 51,455,993	V267I	probably damaging	Het
Washc3	T	A	10: 88,213,706	D63E	probably benign	Het
Wdr89	A	G	12: 75,633,385	S32P	probably damaging	Het
Zfp157	T	C	5: 138,457,051	S504P	possibly damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGTGCCCAGTATTGGTCAACAC -3'
(R):5'- GCCTTTACACCATGACTAAAGGG -3'

Sequencing Primer
(F):5'- GGTCAACACTGAGCTCTCTC -3'
(R):5'- CACCATGACTAAAGGGTTCCTTAGG -3'

Posted On

2018-06-22