Incidental Mutation 'R6615:Hdac5'
ID 526313
Institutional Source Beutler Lab
Gene Symbol Hdac5
Ensembl Gene ENSMUSG00000008855
Gene Name histone deacetylase 5
Synonyms mHDA1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6615 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102194432-102230166 bp(-) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) C to A at 102197056 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008999] [ENSMUST00000070334] [ENSMUST00000078975] [ENSMUST00000107150] [ENSMUST00000107151] [ENSMUST00000107152] [ENSMUST00000124077] [ENSMUST00000140962]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000008999
SMART Domains Protein: ENSMUSP00000008999
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Pfam:HDAC4_Gln 86 174 1e-30 PFAM
low complexity region 233 247 N/A INTRINSIC
low complexity region 322 337 N/A INTRINSIC
low complexity region 502 541 N/A INTRINSIC
low complexity region 560 577 N/A INTRINSIC
coiled coil region 583 617 N/A INTRINSIC
Pfam:Hist_deacetyl 704 1034 1.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070334
SMART Domains Protein: ENSMUSP00000064276
Gene: ENSMUSG00000034793

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078975
SMART Domains Protein: ENSMUSP00000077995
Gene: ENSMUSG00000034793

DomainStartEndE-ValueType
acidPPc 53 187 2.53e-15 SMART
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 284 302 N/A INTRINSIC
transmembrane domain 317 336 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107150
SMART Domains Protein: ENSMUSP00000102768
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
Pfam:HDAC4_Gln 66 155 5.1e-37 PFAM
low complexity region 214 228 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 483 522 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
coiled coil region 564 598 N/A INTRINSIC
Pfam:Hist_deacetyl 685 1015 9.4e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107151
SMART Domains Protein: ENSMUSP00000102769
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 1.1e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 618 931 1.2e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107152
SMART Domains Protein: ENSMUSP00000102770
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:HDAC4_Gln 67 156 3.7e-37 PFAM
low complexity region 215 229 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
low complexity region 484 523 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
coiled coil region 565 599 N/A INTRINSIC
Pfam:Hist_deacetyl 686 1016 6.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124077
SMART Domains Protein: ENSMUSP00000116672
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136304
Predicted Effect probably benign
Transcript: ENSMUST00000140962
SMART Domains Protein: ENSMUSP00000115435
Gene: ENSMUSG00000008855

DomainStartEndE-ValueType
PDB:2VQQ|B 1 71 3e-21 PDB
transmembrane domain 118 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137787
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the class II histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. It coimmunoprecipitates only with HDAC3 family member and might form multicomplex proteins. It also interacts with myocyte enhancer factor-2 (MEF2) proteins, resulting in repression of MEF2-dependent genes. This gene is thought to be associated with colon cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and display cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,112,485 N402K probably damaging Het
Avl9 T C 6: 56,753,885 V598A probably benign Het
Bcar3 T A 3: 122,426,633 S60T probably benign Het
Bean1 CT C 8: 104,182,032 probably null Homo
Calm3 A G 7: 16,917,583 probably null Het
Ccdc113 A C 8: 95,545,992 E242D probably benign Het
Celsr1 C T 15: 85,902,114 probably null Het
Clhc1 T A 11: 29,578,149 M559K possibly damaging Het
Dhx36 T A 3: 62,488,917 I440L probably benign Het
Dnah7c A T 1: 46,515,439 T445S probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Dsc2 T A 18: 20,032,519 H843L possibly damaging Het
F11 T C 8: 45,248,774 Y333C probably benign Het
Fbxo41 T C 6: 85,478,523 T560A possibly damaging Het
Fbxo7 A T 10: 86,044,534 H282L possibly damaging Het
Gmnc T G 16: 26,960,528 D243A probably benign Het
Krt87 A G 15: 101,436,562 V188A probably benign Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrk1 A T 7: 66,281,648 L55Q probably damaging Het
Ltbp2 C T 12: 84,813,317 C621Y probably damaging Het
March8 A G 6: 116,405,663 E147G probably damaging Het
Muc16 T G 9: 18,647,188 H2603P unknown Het
Nipa1 T A 7: 55,979,823 N181Y probably damaging Het
Olfr1281 A G 2: 111,329,112 D231G probably benign Het
Olfr297 A G 7: 86,526,912 T52A probably benign Het
Olfr562-ps1 T C 7: 102,781,787 F104L probably damaging Het
Olfr855 A G 9: 19,584,989 I151V probably benign Het
Olfr92 G A 17: 37,111,602 P127S probably damaging Het
Pcf11 T A 7: 92,657,882 Q1026L probably damaging Het
Ptch1 T G 13: 63,539,830 K378T possibly damaging Het
Ptprm C T 17: 67,353,956 probably null Het
Pxmp2 C A 5: 110,277,707 W154L possibly damaging Het
Rdh7 T G 10: 127,884,622 S294R probably damaging Het
Rexo1 C T 10: 80,544,014 R994Q possibly damaging Het
Sacs A G 14: 61,208,934 T2810A probably benign Het
Serpina3c A T 12: 104,151,721 H119Q possibly damaging Het
Slc12a2 T G 18: 57,898,128 I335R probably damaging Het
Slc25a13 C T 6: 6,073,454 R468Q probably damaging Het
Slc5a6 C T 5: 31,036,830 V628I probably benign Het
Srsf2 T C 11: 116,853,079 probably null Het
Sugp2 A G 8: 70,242,770 Q131R possibly damaging Het
Syne1 T C 10: 5,301,340 R2525G probably damaging Het
Tarsl2 T C 7: 65,678,142 F533S probably damaging Het
Tmem8b G T 4: 43,682,249 G82W probably damaging Het
Unc13c A G 9: 73,930,608 I987T possibly damaging Het
Usp44 T C 10: 93,846,489 V267A possibly damaging Het
Wac C A 18: 7,868,884 probably null Het
Xkr5 T C 8: 18,933,553 I658V probably benign Het
Zbtb38 A T 9: 96,686,654 Y792* probably null Het
Other mutations in Hdac5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hdac5 APN 11 102197342 missense probably damaging 1.00
IGL01614:Hdac5 APN 11 102200028 missense probably benign 0.38
IGL01799:Hdac5 APN 11 102200085 missense possibly damaging 0.71
IGL02839:Hdac5 APN 11 102204908 missense probably damaging 1.00
E0354:Hdac5 UTSW 11 102202146 unclassified probably benign
R0544:Hdac5 UTSW 11 102196096 missense probably damaging 1.00
R0612:Hdac5 UTSW 11 102196252 missense possibly damaging 0.92
R0632:Hdac5 UTSW 11 102205812 missense probably damaging 1.00
R0659:Hdac5 UTSW 11 102196024 missense probably damaging 1.00
R0930:Hdac5 UTSW 11 102204646 missense probably benign 0.02
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1195:Hdac5 UTSW 11 102205506 missense probably damaging 0.99
R1475:Hdac5 UTSW 11 102202186 missense possibly damaging 0.94
R1491:Hdac5 UTSW 11 102201253 missense probably benign
R1596:Hdac5 UTSW 11 102204656 splice site probably null
R1673:Hdac5 UTSW 11 102198805 missense probably damaging 1.00
R1783:Hdac5 UTSW 11 102200516 missense probably benign
R1932:Hdac5 UTSW 11 102195872 splice site probably benign
R2197:Hdac5 UTSW 11 102204514 missense probably damaging 1.00
R2348:Hdac5 UTSW 11 102200014 missense probably benign 0.44
R2518:Hdac5 UTSW 11 102197136 missense probably damaging 1.00
R3081:Hdac5 UTSW 11 102205610 missense probably damaging 1.00
R3622:Hdac5 UTSW 11 102195818 missense probably benign 0.34
R4543:Hdac5 UTSW 11 102213944 intron probably benign
R4559:Hdac5 UTSW 11 102199102 unclassified probably benign
R4661:Hdac5 UTSW 11 102205849 missense probably damaging 1.00
R4682:Hdac5 UTSW 11 102206630 missense probably null 0.99
R4708:Hdac5 UTSW 11 102202193 missense probably damaging 0.97
R4933:Hdac5 UTSW 11 102200563 unclassified probably benign
R4957:Hdac5 UTSW 11 102205256 unclassified probably benign
R4991:Hdac5 UTSW 11 102205624 missense probably damaging 1.00
R5090:Hdac5 UTSW 11 102197713 missense probably damaging 1.00
R5103:Hdac5 UTSW 11 102196283 missense probably damaging 0.98
R5330:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5331:Hdac5 UTSW 11 102197354 missense probably damaging 1.00
R5386:Hdac5 UTSW 11 102202141 missense possibly damaging 0.71
R5449:Hdac5 UTSW 11 102196097 nonsense probably null
R5682:Hdac5 UTSW 11 102213923 intron probably benign
R6705:Hdac5 UTSW 11 102201236 missense probably damaging 0.99
R6875:Hdac5 UTSW 11 102202276 missense probably damaging 1.00
R6952:Hdac5 UTSW 11 102204960 missense probably benign
R7179:Hdac5 UTSW 11 102204559 missense possibly damaging 0.74
R7368:Hdac5 UTSW 11 102197381 missense probably null 1.00
R8140:Hdac5 UTSW 11 102197355 missense probably damaging 1.00
R8151:Hdac5 UTSW 11 102206468 missense probably benign 0.00
R8684:Hdac5 UTSW 11 102205321 missense probably benign 0.01
R8719:Hdac5 UTSW 11 102207137 missense probably benign 0.18
R8751:Hdac5 UTSW 11 102218454 missense probably benign 0.19
R8893:Hdac5 UTSW 11 102206686 missense possibly damaging 0.82
R9337:Hdac5 UTSW 11 102205352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCGGGAAGATCAAGGC -3'
(R):5'- ATGGCCTCGATGGAGAACAG -3'

Sequencing Primer
(F):5'- TCAAGGCCAGAGAGCTTCAGTG -3'
(R):5'- CCTCGATGGAGAACAGAGCATG -3'
Posted On 2018-06-22