Mutagenetix > Incidental Mutation

Incidental Mutation 'R6632:Akap9'

526330

Institutional Source

Beutler Lab

Gene Symbol

Akap9

Ensembl Gene

ENSMUSG00000040407

Gene Name

A kinase (PRKA) anchor protein (yotiao) 9

Synonyms

AKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.601) question?

Stock #

R6632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3928054-4081310 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 4013842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000044492]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000044492

SMART Domains

Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
Blast:HPT	126	197	6e-21	BLAST
low complexity region	237	249	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
coiled coil region	404	593	N/A	INTRINSIC
coiled coil region	622	756	N/A	INTRINSIC
coiled coil region	777	843	N/A	INTRINSIC
coiled coil region	888	958	N/A	INTRINSIC
low complexity region	982	997	N/A	INTRINSIC
coiled coil region	1037	1065	N/A	INTRINSIC
low complexity region	1233	1246	N/A	INTRINSIC
internal_repeat_2	1247	1312	7.75e-5	PROSPERO
internal_repeat_1	1377	1485	2.63e-5	PROSPERO
coiled coil region	1522	1589	N/A	INTRINSIC
coiled coil region	1789	2107	N/A	INTRINSIC
coiled coil region	2132	2318	N/A	INTRINSIC
internal_repeat_1	2322	2445	2.63e-5	PROSPERO
coiled coil region	2455	2494	N/A	INTRINSIC
low complexity region	2587	2598	N/A	INTRINSIC
low complexity region	2627	2640	N/A	INTRINSIC
internal_repeat_2	2934	2997	7.75e-5	PROSPERO
low complexity region	3000	3016	N/A	INTRINSIC
coiled coil region	3109	3307	N/A	INTRINSIC
coiled coil region	3455	3493	N/A	INTRINSIC
coiled coil region	3521	3556	N/A	INTRINSIC
Pfam:PACT_coil_coil	3576	3657	1.2e-27	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000044492

SMART Domains

Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
Blast:HPT	126	197	6e-21	BLAST
low complexity region	237	249	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
coiled coil region	404	593	N/A	INTRINSIC
coiled coil region	622	756	N/A	INTRINSIC
coiled coil region	777	843	N/A	INTRINSIC
coiled coil region	888	958	N/A	INTRINSIC
low complexity region	982	997	N/A	INTRINSIC
coiled coil region	1037	1065	N/A	INTRINSIC
low complexity region	1233	1246	N/A	INTRINSIC
internal_repeat_2	1247	1312	7.75e-5	PROSPERO
internal_repeat_1	1377	1485	2.63e-5	PROSPERO
coiled coil region	1522	1589	N/A	INTRINSIC
coiled coil region	1789	2107	N/A	INTRINSIC
coiled coil region	2132	2318	N/A	INTRINSIC
internal_repeat_1	2322	2445	2.63e-5	PROSPERO
coiled coil region	2455	2494	N/A	INTRINSIC
low complexity region	2587	2598	N/A	INTRINSIC
low complexity region	2627	2640	N/A	INTRINSIC
internal_repeat_2	2934	2997	7.75e-5	PROSPERO
low complexity region	3000	3016	N/A	INTRINSIC
coiled coil region	3109	3307	N/A	INTRINSIC
coiled coil region	3455	3493	N/A	INTRINSIC
coiled coil region	3521	3556	N/A	INTRINSIC
Pfam:PACT_coil_coil	3576	3657	1.2e-27	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (38/38)

MGI Phenotype

PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,281,067	S758P	possibly damaging	Het
Abca3	C	G	17: 24,384,470	D545E	probably benign	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arpp21	G	A	9: 112,127,356	Q518*	probably null	Het
Atp9b	G	A	18: 80,808,649	R410W	probably damaging	Het
Cacna2d3	T	C	14: 28,905,265	*265W	probably null	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cep164	T	C	9: 45,779,790	K1231E	possibly damaging	Het
Cnot1	A	G	8: 95,773,267		probably benign	Het
Cpne2	T	C	8: 94,554,955	V206A	probably benign	Het
Dchs1	A	G	7: 105,761,878	Y1647H	probably damaging	Het
Dnaaf5	A	G	5: 139,170,333	T590A	probably benign	Het
Eif4g1	A	T	16: 20,685,520	I1068F	probably damaging	Het
Ephb4	A	T	5: 137,366,587	K639N	probably damaging	Het
Gcc2	A	G	10: 58,270,049		probably null	Het
Gm35315	A	C	5: 110,079,263	Y103*	probably null	Het
Hsd17b4	A	G	18: 50,179,102	K578R	possibly damaging	Het
Ice2	T	C	9: 69,428,452	S906P	probably benign	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp1b	A	T	2: 40,725,442	W3650R	probably benign	Het
Mcoln3	C	T	3: 146,128,187	H161Y	probably benign	Het
Mphosph10	A	T	7: 64,385,819	M368K	probably damaging	Het
Msh2	A	C	17: 87,712,666	K567Q	possibly damaging	Het
N4bp3	T	C	11: 51,643,949	E429G	possibly damaging	Het
Nrxn3	G	A	12: 89,193,154	A17T	probably damaging	Het
Olfr1459	T	A	19: 13,146,188	Y157F	probably benign	Het
Olfr171	T	C	16: 19,625,023	T26A	probably benign	Het
P4ha2	G	T	11: 54,117,648	R227L	probably benign	Het
Pfkfb4	G	A	9: 109,009,562		probably null	Het
Ror1	A	G	4: 100,442,106	N892S	probably benign	Het
Scn9a	G	T	2: 66,483,502	D1957E	probably benign	Het
Sec24a	A	T	11: 51,713,649	Y713*	probably null	Het
Serpinb1b	T	A	13: 33,087,455	F70I	probably damaging	Het
Setdb1	T	C	3: 95,324,149	Y1284C	probably damaging	Het
Suco	A	T	1: 161,828,240	M1030K	possibly damaging	Het
Syne1	A	T	10: 5,215,667		probably null	Het

Other mutations in Akap9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Akap9	APN	5	4046639	missense	probably damaging	0.97
IGL00642:Akap9	APN	5	3960842	missense	probably damaging	0.99
IGL00786:Akap9	APN	5	4070522	missense	probably damaging	1.00
IGL00788:Akap9	APN	5	4060480	missense	probably damaging	1.00
IGL00969:Akap9	APN	5	4001550	missense	probably benign
IGL01014:Akap9	APN	5	3968683	missense	probably benign	0.41
IGL01302:Akap9	APN	5	3970711	missense	probably benign	0.27
IGL01610:Akap9	APN	5	4032839	missense	possibly damaging	0.95
IGL01620:Akap9	APN	5	3960218	missense	probably benign	0.11
IGL01862:Akap9	APN	5	3951705	missense	probably damaging	0.99
IGL01862:Akap9	APN	5	4065856	missense	probably damaging	0.99
IGL02151:Akap9	APN	5	4032728	nonsense	probably null
IGL02635:Akap9	APN	5	4070500	missense	possibly damaging	0.59
IGL02858:Akap9	APN	5	4069130	missense	possibly damaging	0.88
IGL02967:Akap9	APN	5	3976164	missense	probably benign	0.07
IGL03064:Akap9	APN	5	3968755	missense	probably damaging	1.00
IGL03289:Akap9	APN	5	4077261	missense	probably damaging	1.00
Andy	UTSW	5	3961764	nonsense	probably null
blimey	UTSW	5	4070397	nonsense	probably null
hoarder	UTSW	5	4069089	missense	probably benign	0.00
marinarum	UTSW	5	4013875	nonsense	probably null
miser	UTSW	5	4046064	missense	probably benign	0.13
naviculus	UTSW	5	3960865	missense	probably damaging	0.98
thrifty	UTSW	5	3976209	missense	probably damaging	0.99
wee_one	UTSW	5	4043925	missense	probably damaging	1.00
FR4449:Akap9	UTSW	5	3981214	unclassified	probably benign
PIT1430001:Akap9	UTSW	5	4029849	missense	probably damaging	1.00
PIT4366001:Akap9	UTSW	5	4046221	missense	probably benign	0.24
R0088:Akap9	UTSW	5	3961946	missense	probably benign	0.22
R0309:Akap9	UTSW	5	4069038	missense	probably benign	0.01
R0387:Akap9	UTSW	5	3951678	splice site	probably benign
R0440:Akap9	UTSW	5	4064569	missense	probably damaging	0.99
R0441:Akap9	UTSW	5	3961714	missense	probably benign	0.15
R0491:Akap9	UTSW	5	3972851	unclassified	probably benign
R0501:Akap9	UTSW	5	3970685	missense	probably damaging	1.00
R0507:Akap9	UTSW	5	4069043	missense	probably benign	0.41
R0544:Akap9	UTSW	5	4069185	missense	probably benign	0.22
R0581:Akap9	UTSW	5	4050620	missense	probably benign	0.03
R0611:Akap9	UTSW	5	3954870	missense	probably benign	0.00
R0620:Akap9	UTSW	5	4064136	missense	probably damaging	0.98
R0639:Akap9	UTSW	5	4060318	missense	probably damaging	1.00
R0932:Akap9	UTSW	5	4046492	missense	possibly damaging	0.77
R0944:Akap9	UTSW	5	4064742	splice site	probably null
R1101:Akap9	UTSW	5	4046205	missense	probably benign	0.00
R1159:Akap9	UTSW	5	3960865	missense	probably damaging	0.98
R1170:Akap9	UTSW	5	4055671	missense	probably benign
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1453:Akap9	UTSW	5	3975614	splice site	probably null
R1551:Akap9	UTSW	5	4069174	missense	probably benign	0.02
R1608:Akap9	UTSW	5	3961783	missense	probably damaging	1.00
R1652:Akap9	UTSW	5	4077210	missense	probably damaging	1.00
R1659:Akap9	UTSW	5	4064633	missense	probably damaging	1.00
R1713:Akap9	UTSW	5	4039345	critical splice donor site	probably null
R1719:Akap9	UTSW	5	3957645	nonsense	probably null
R1720:Akap9	UTSW	5	3972791	missense	possibly damaging	0.63
R1757:Akap9	UTSW	5	4001667	missense	probably benign	0.41
R1872:Akap9	UTSW	5	4001406	missense	probably damaging	1.00
R1876:Akap9	UTSW	5	3961809	missense	probably benign	0.28
R1881:Akap9	UTSW	5	4050173	missense	probably benign
R1950:Akap9	UTSW	5	3960677	missense	probably damaging	1.00
R1980:Akap9	UTSW	5	3972771	missense	probably damaging	0.99
R1993:Akap9	UTSW	5	4038520	splice site	probably null
R2008:Akap9	UTSW	5	3960131	missense	possibly damaging	0.47
R2020:Akap9	UTSW	5	3961967	missense	probably damaging	1.00
R2051:Akap9	UTSW	5	3975685	nonsense	probably null
R2061:Akap9	UTSW	5	3961010	missense	probably damaging	1.00
R2109:Akap9	UTSW	5	4044847	missense	possibly damaging	0.47
R2135:Akap9	UTSW	5	4064509	missense	probably damaging	1.00
R2225:Akap9	UTSW	5	4077271	missense	probably damaging	0.96
R2232:Akap9	UTSW	5	4046603	missense	probably damaging	1.00
R2424:Akap9	UTSW	5	4065279	missense	probably damaging	0.97
R2483:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R2879:Akap9	UTSW	5	3976353	intron	probably benign
R3622:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3623:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3624:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3722:Akap9	UTSW	5	4070351	missense	probably damaging	1.00
R3806:Akap9	UTSW	5	3954410	missense	probably benign	0.00
R3919:Akap9	UTSW	5	3961764	nonsense	probably null
R4023:Akap9	UTSW	5	3992077	missense	possibly damaging	0.66
R4093:Akap9	UTSW	5	4043996	missense	probably damaging	0.99
R4434:Akap9	UTSW	5	4032708	missense	probably damaging	0.99
R4529:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4530:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4532:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4533:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4585:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4586:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4655:Akap9	UTSW	5	4046403	missense	probably benign	0.14
R4676:Akap9	UTSW	5	4032774	missense	probably damaging	1.00
R4676:Akap9	UTSW	5	4064515	nonsense	probably null
R4724:Akap9	UTSW	5	4055339	missense	probably benign
R4731:Akap9	UTSW	5	3962266	missense	possibly damaging	0.54
R4732:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4733:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4743:Akap9	UTSW	5	3961013	missense	probably damaging	1.00
R4749:Akap9	UTSW	5	3968737	missense	probably benign	0.41
R4756:Akap9	UTSW	5	4001418	missense	probably damaging	0.99
R4757:Akap9	UTSW	5	4008382	missense	probably damaging	1.00
R4860:Akap9	UTSW	5	4034916	intron	probably benign
R4937:Akap9	UTSW	5	4050145	splice site	probably null
R4960:Akap9	UTSW	5	3957664	missense	probably benign	0.15
R4974:Akap9	UTSW	5	3961466	missense	possibly damaging	0.81
R5101:Akap9	UTSW	5	4001748	missense	probably damaging	0.96
R5160:Akap9	UTSW	5	4030007	missense	probably damaging	1.00
R5200:Akap9	UTSW	5	3960734	missense	probably benign	0.00
R5245:Akap9	UTSW	5	3976209	missense	probably damaging	0.99
R5293:Akap9	UTSW	5	3948687	missense	probably damaging	0.99
R5408:Akap9	UTSW	5	4058458	missense	possibly damaging	0.84
R5507:Akap9	UTSW	5	3968683	missense	probably benign	0.41
R5517:Akap9	UTSW	5	4001665	missense	possibly damaging	0.76
R5579:Akap9	UTSW	5	4064714	missense	possibly damaging	0.93
R5619:Akap9	UTSW	5	3954760	intron	probably benign
R5645:Akap9	UTSW	5	4050590	missense	probably benign	0.09
R5669:Akap9	UTSW	5	4050540	nonsense	probably null
R5686:Akap9	UTSW	5	3971926	missense	probably benign	0.00
R5697:Akap9	UTSW	5	3960170	missense	possibly damaging	0.92
R5821:Akap9	UTSW	5	4046064	missense	probably benign	0.13
R5875:Akap9	UTSW	5	4077285	missense	probably benign	0.01
R5897:Akap9	UTSW	5	4077904	missense	probably benign	0.23
R5999:Akap9	UTSW	5	4043925	missense	probably damaging	1.00
R6025:Akap9	UTSW	5	4032801	missense	probably damaging	1.00
R6078:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6138:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6225:Akap9	UTSW	5	3962105	missense	probably damaging	1.00
R6243:Akap9	UTSW	5	4065000	splice site	probably null
R6326:Akap9	UTSW	5	3962061	missense	probably damaging	1.00
R6564:Akap9	UTSW	5	4028491	missense	probably damaging	0.98
R6617:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6625:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6677:Akap9	UTSW	5	4029869	missense	probably benign	0.21
R6717:Akap9	UTSW	5	4064086	missense	probably damaging	1.00
R6893:Akap9	UTSW	5	3961709	missense	probably benign	0.32
R6915:Akap9	UTSW	5	3960551	missense	probably benign	0.03
R6938:Akap9	UTSW	5	4046628	missense	possibly damaging	0.91
R6972:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6973:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6993:Akap9	UTSW	5	4065866	missense	possibly damaging	0.65
R7032:Akap9	UTSW	5	3954896	missense	probably benign
R7164:Akap9	UTSW	5	4060364	missense	probably damaging	0.96
R7170:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7192:Akap9	UTSW	5	4005723	splice site	probably null
R7284:Akap9	UTSW	5	3956246	missense	probably damaging	1.00
R7299:Akap9	UTSW	5	4032696	missense	probably damaging	1.00
R7313:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7326:Akap9	UTSW	5	4045930	missense	possibly damaging	0.47
R7343:Akap9	UTSW	5	4046364	missense	probably damaging	0.99
R7455:Akap9	UTSW	5	3972792	missense	probably benign	0.03
R7482:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7489:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7525:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7528:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7576:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7577:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7578:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7610:Akap9	UTSW	5	3957677	missense	possibly damaging	0.95
R7658:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7754:Akap9	UTSW	5	4046736	missense	probably benign	0.03
R7818:Akap9	UTSW	5	4013875	nonsense	probably null
R7979:Akap9	UTSW	5	4050381	missense	probably benign
R7991:Akap9	UTSW	5	4064949	splice site	probably null
R8036:Akap9	UTSW	5	4070397	nonsense	probably null
R8054:Akap9	UTSW	5	4038707	critical splice donor site	probably null
R8116:Akap9	UTSW	5	4061183	missense	probably benign	0.04
R8150:Akap9	UTSW	5	3961982	missense	probably damaging	1.00
R8234:Akap9	UTSW	5	4044845	missense	probably benign	0.18
R8348:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8365:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8366:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8448:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8466:Akap9	UTSW	5	4038659	missense	probably damaging	1.00
R8772:Akap9	UTSW	5	4046255	missense	probably damaging	1.00
R8881:Akap9	UTSW	5	3961279	missense
R8937:Akap9	UTSW	5	4044048	missense	possibly damaging	0.78
R8956:Akap9	UTSW	5	3948805	missense	possibly damaging	0.79
R9000:Akap9	UTSW	5	4055650	missense	probably benign
R9049:Akap9	UTSW	5	4064597	missense
R9074:Akap9	UTSW	5	4077959	missense	probably benign	0.40
R9124:Akap9	UTSW	5	4061284	missense	probably damaging	0.99
R9129:Akap9	UTSW	5	4069089	missense	probably benign	0.00
R9371:Akap9	UTSW	5	3961852	missense	possibly damaging	0.83
R9424:Akap9	UTSW	5	3962223	nonsense	probably null
R9424:Akap9	UTSW	5	3962224	nonsense	probably null
R9509:Akap9	UTSW	5	4046349	missense	probably benign
R9515:Akap9	UTSW	5	4055709	missense	probably damaging	1.00
R9567:Akap9	UTSW	5	4077311	missense	possibly damaging	0.89
R9587:Akap9	UTSW	5	4069149	missense	probably damaging	1.00
R9619:Akap9	UTSW	5	4044833	missense	probably damaging	1.00
R9635:Akap9	UTSW	5	4050545	missense	probably benign	0.20
R9680:Akap9	UTSW	5	3961587	missense	probably benign	0.03
R9691:Akap9	UTSW	5	3960491	missense	probably damaging	1.00
R9726:Akap9	UTSW	5	4003757	missense	probably benign	0.39
U15987:Akap9	UTSW	5	4067924	critical splice donor site	probably null
X0026:Akap9	UTSW	5	4014039	missense	probably damaging	1.00
X0057:Akap9	UTSW	5	3975598	critical splice acceptor site	probably null
Z1176:Akap9	UTSW	5	3962251	missense	probably damaging	0.96
Z1177:Akap9	UTSW	5	4046189	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTAGTTTCGGCACAGCAC -3'
(R):5'- TTTTCAACAGCTGCTTGTAGTCG -3'

Sequencing Primer
(F):5'- GCACAGCACTGCCCTTTTG -3'
(R):5'- ACAGCTGCTTGTAGTCGAGAGC -3'

Posted On

2018-06-22