Incidental Mutation 'R6632:Pfkfb4'
ID526331
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6632 (G1)
Quality Score83.0076
Status Validated
Chromosome9
Chromosomal Location108991778-109032228 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 109009562 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
Predicted Effect probably null
Transcript: ENSMUST00000051873
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect probably null
Transcript: ENSMUST00000198140
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199184
Predicted Effect probably benign
Transcript: ENSMUST00000199591
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200229
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,281,067 S758P possibly damaging Het
Abca3 C G 17: 24,384,470 D545E probably benign Het
Akap9 T A 5: 4,013,842 probably null Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Arpp21 G A 9: 112,127,356 Q518* probably null Het
Atp9b G A 18: 80,808,649 R410W probably damaging Het
Cacna2d3 T C 14: 28,905,265 *265W probably null Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cep164 T C 9: 45,779,790 K1231E possibly damaging Het
Cnot1 A G 8: 95,773,267 probably benign Het
Cpne2 T C 8: 94,554,955 V206A probably benign Het
Dchs1 A G 7: 105,761,878 Y1647H probably damaging Het
Dnaaf5 A G 5: 139,170,333 T590A probably benign Het
Eif4g1 A T 16: 20,685,520 I1068F probably damaging Het
Ephb4 A T 5: 137,366,587 K639N probably damaging Het
Gcc2 A G 10: 58,270,049 probably null Het
Gm35315 A C 5: 110,079,263 Y103* probably null Het
Hsd17b4 A G 18: 50,179,102 K578R possibly damaging Het
Ice2 T C 9: 69,428,452 S906P probably benign Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1b A T 2: 40,725,442 W3650R probably benign Het
Mcoln3 C T 3: 146,128,187 H161Y probably benign Het
Mphosph10 A T 7: 64,385,819 M368K probably damaging Het
Msh2 A C 17: 87,712,666 K567Q possibly damaging Het
N4bp3 T C 11: 51,643,949 E429G possibly damaging Het
Nrxn3 G A 12: 89,193,154 A17T probably damaging Het
Olfr1459 T A 19: 13,146,188 Y157F probably benign Het
Olfr171 T C 16: 19,625,023 T26A probably benign Het
P4ha2 G T 11: 54,117,648 R227L probably benign Het
Ror1 A G 4: 100,442,106 N892S probably benign Het
Scn9a G T 2: 66,483,502 D1957E probably benign Het
Sec24a A T 11: 51,713,649 Y713* probably null Het
Serpinb1b T A 13: 33,087,455 F70I probably damaging Het
Setdb1 T C 3: 95,324,149 Y1284C probably damaging Het
Suco A T 1: 161,828,240 M1030K possibly damaging Het
Syne1 A T 10: 5,215,667 probably null Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108999134 missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 109028942 missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 109025110 missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 109030336 missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 109007296 missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108999154 missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 109007701 missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 109010643 missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108998889 missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 109027742 splice site probably benign
R0511:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 109007726 missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 109027620 missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 109007305 missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108999169 missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 109005609 missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 109025042 splice site probably benign
R5470:Pfkfb4 UTSW 9 109027593 missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 109008421 missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 109030394 unclassified probably benign
R6139:Pfkfb4 UTSW 9 109027757 missense probably damaging 1.00
R6873:Pfkfb4 UTSW 9 109010335 splice site probably null
R6958:Pfkfb4 UTSW 9 109010547 missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108999154 missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 109007302 missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 109027608 missense probably damaging 0.99
R7284:Pfkfb4 UTSW 9 109011240 missense possibly damaging 0.88
R7903:Pfkfb4 UTSW 9 108998951 missense probably damaging 1.00
R7973:Pfkfb4 UTSW 9 109025111 missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 109005599 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CACAGTGTTAAGTGAAAGGCTG -3'
(R):5'- GGTGAAGCAGCTGAGAGTTC -3'

Sequencing Primer
(F):5'- TATATGATCCAAGGAACACAGCAG -3'
(R):5'- GAGTTCCCGGATGTTCTCATACAAG -3'
Posted On2018-06-22