Mutagenetix > Incidental Mutation

Incidental Mutation 'R6632:Pfkfb4'

526331

Institutional Source

Beutler Lab

Gene Symbol

Pfkfb4

Ensembl Gene

ENSMUSG00000025648

Gene Name

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6632 (G1)

Quality Score

83.0076

Status

Validated

Chromosome

Chromosomal Location

108991778-109032228 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 109009562 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]

AlphaFold

Q6DTY7

Predicted Effect

probably null
Transcript: ENSMUST00000051873

SMART Domains

Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	3.2e-105	PFAM
Pfam:AAA_33	41	199	2.3e-8	PFAM
PGAM	251	398	4.39e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196249

Predicted Effect

probably null
Transcript: ENSMUST00000198140

SMART Domains

Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	1.9e-105	PFAM
Pfam:AAA_33	41	198	8.5e-10	PFAM
PGAM	251	398	4.39e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199184

Predicted Effect

probably benign
Transcript: ENSMUST00000199591

SMART Domains

Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	249	1.4e-105	PFAM
Pfam:AAA_33	41	198	6.6e-10	PFAM
PGAM	251	396	4.98e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200229

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,281,067	S758P	possibly damaging	Het
Abca3	C	G	17: 24,384,470	D545E	probably benign	Het
Akap9	T	A	5: 4,013,842		probably null	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arpp21	G	A	9: 112,127,356	Q518*	probably null	Het
Atp9b	G	A	18: 80,808,649	R410W	probably damaging	Het
Cacna2d3	T	C	14: 28,905,265	*265W	probably null	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cep164	T	C	9: 45,779,790	K1231E	possibly damaging	Het
Cnot1	A	G	8: 95,773,267		probably benign	Het
Cpne2	T	C	8: 94,554,955	V206A	probably benign	Het
Dchs1	A	G	7: 105,761,878	Y1647H	probably damaging	Het
Dnaaf5	A	G	5: 139,170,333	T590A	probably benign	Het
Eif4g1	A	T	16: 20,685,520	I1068F	probably damaging	Het
Ephb4	A	T	5: 137,366,587	K639N	probably damaging	Het
Gcc2	A	G	10: 58,270,049		probably null	Het
Gm35315	A	C	5: 110,079,263	Y103*	probably null	Het
Hsd17b4	A	G	18: 50,179,102	K578R	possibly damaging	Het
Ice2	T	C	9: 69,428,452	S906P	probably benign	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp1b	A	T	2: 40,725,442	W3650R	probably benign	Het
Mcoln3	C	T	3: 146,128,187	H161Y	probably benign	Het
Mphosph10	A	T	7: 64,385,819	M368K	probably damaging	Het
Msh2	A	C	17: 87,712,666	K567Q	possibly damaging	Het
N4bp3	T	C	11: 51,643,949	E429G	possibly damaging	Het
Nrxn3	G	A	12: 89,193,154	A17T	probably damaging	Het
Olfr1459	T	A	19: 13,146,188	Y157F	probably benign	Het
Olfr171	T	C	16: 19,625,023	T26A	probably benign	Het
P4ha2	G	T	11: 54,117,648	R227L	probably benign	Het
Ror1	A	G	4: 100,442,106	N892S	probably benign	Het
Scn9a	G	T	2: 66,483,502	D1957E	probably benign	Het
Sec24a	A	T	11: 51,713,649	Y713*	probably null	Het
Serpinb1b	T	A	13: 33,087,455	F70I	probably damaging	Het
Setdb1	T	C	3: 95,324,149	Y1284C	probably damaging	Het
Suco	A	T	1: 161,828,240	M1030K	possibly damaging	Het
Syne1	A	T	10: 5,215,667		probably null	Het

Other mutations in Pfkfb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01653:Pfkfb4	APN	9	108999134	missense	probably damaging	1.00
IGL01978:Pfkfb4	APN	9	109028942	missense	probably damaging	1.00
IGL02119:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02121:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02122:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02123:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02125:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02126:Pfkfb4	APN	9	109025110	missense	probably damaging	1.00
IGL02506:Pfkfb4	APN	9	109030336	missense	probably benign	0.00
IGL02881:Pfkfb4	APN	9	109007296	missense	probably null	1.00
PIT4466001:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.12
PIT4472001:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.12
R0087:Pfkfb4	UTSW	9	109007701	missense	probably damaging	1.00
R0101:Pfkfb4	UTSW	9	109010643	missense	probably benign	0.03
R0109:Pfkfb4	UTSW	9	108998889	missense	probably benign	0.27
R0109:Pfkfb4	UTSW	9	108998889	missense	probably benign	0.27
R0379:Pfkfb4	UTSW	9	109027742	splice site	probably benign
R0511:Pfkfb4	UTSW	9	109027757	missense	probably damaging	1.00
R1146:Pfkfb4	UTSW	9	109007726	missense	probably benign	0.00
R1146:Pfkfb4	UTSW	9	109007726	missense	probably benign	0.00
R1490:Pfkfb4	UTSW	9	109027620	missense	probably damaging	1.00
R1521:Pfkfb4	UTSW	9	109007305	missense	probably damaging	1.00
R1932:Pfkfb4	UTSW	9	108999169	missense	probably damaging	1.00
R2214:Pfkfb4	UTSW	9	109005609	missense	probably benign	0.17
R3112:Pfkfb4	UTSW	9	109025042	splice site	probably benign
R5470:Pfkfb4	UTSW	9	109027593	missense	probably damaging	1.00
R5646:Pfkfb4	UTSW	9	109008421	missense	probably damaging	1.00
R5930:Pfkfb4	UTSW	9	109030394	unclassified	probably benign
R6139:Pfkfb4	UTSW	9	109027757	missense	probably damaging	1.00
R6873:Pfkfb4	UTSW	9	109010335	splice site	probably null
R6958:Pfkfb4	UTSW	9	109010547	missense	probably damaging	1.00
R7098:Pfkfb4	UTSW	9	108999154	missense	probably benign	0.05
R7131:Pfkfb4	UTSW	9	109007302	missense	probably benign	0.21
R7148:Pfkfb4	UTSW	9	109027608	missense	probably damaging	0.99
R7284:Pfkfb4	UTSW	9	109011240	missense	possibly damaging	0.88
R7903:Pfkfb4	UTSW	9	108998951	missense	probably damaging	1.00
R7973:Pfkfb4	UTSW	9	109025111	missense	probably damaging	1.00
R8506:Pfkfb4	UTSW	9	109005599	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- CACAGTGTTAAGTGAAAGGCTG -3'
(R):5'- GGTGAAGCAGCTGAGAGTTC -3'

Sequencing Primer
(F):5'- TATATGATCCAAGGAACACAGCAG -3'
(R):5'- GAGTTCCCGGATGTTCTCATACAAG -3'

Posted On

2018-06-22