Incidental Mutation 'R6568:Doc2b'
ID526340
Institutional Source Beutler Lab
Gene Symbol Doc2b
Ensembl Gene ENSMUSG00000020848
Gene Namedouble C2, beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6568 (G1)
Quality Score213.009
Status Not validated
Chromosome11
Chromosomal Location75768966-75796049 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to C at 75776994 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021209]
Predicted Effect probably null
Transcript: ENSMUST00000021209
SMART Domains Protein: ENSMUSP00000021209
Gene: ENSMUSG00000020848

DomainStartEndE-ValueType
Blast:C2 9 38 8e-8 BLAST
low complexity region 41 77 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
C2 142 247 4.69e-21 SMART
C2 282 396 4.69e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a calcium sensor involved in glucose-stimulated insulin secretion, spontaneous neurotransmitter release, and enhanced SNARE-dependent vesicle fusion. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced frequency of spontaneous neurotransmitter release events with cerebellar Purkinje cells showing continuous spiking without interruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T C 1: 138,852,134 K127E possibly damaging Het
Ash1l G A 3: 89,052,037 M2240I probably benign Het
Ccr5 G A 9: 124,125,199 A280T probably damaging Het
Ceacam5 C T 7: 17,745,491 L178F probably damaging Het
Col2a1 T C 15: 97,977,276 N1259S unknown Het
Fryl T C 5: 73,059,516 N2144D probably damaging Het
Gm10093 A G 17: 78,492,588 Y336C probably damaging Het
Gm5096 A T 18: 87,757,442 Y363F probably benign Het
Ighv1-34 A T 12: 114,851,611 W5R probably benign Het
Kdr A G 5: 75,961,774 V497A probably benign Het
Miip T A 4: 147,865,915 M75L probably benign Het
Mplkip T C 13: 17,695,677 S65P probably damaging Het
Ms4a13 A G 19: 11,191,559 L34P probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nek1 T C 8: 61,106,821 S896P probably benign Het
Olfr199 A T 16: 59,216,278 C112S probably benign Het
Polr3b T A 10: 84,634,903 M136K probably damaging Het
Rgsl1 A C 1: 153,821,546 W508G possibly damaging Het
Ros1 A T 10: 52,162,812 M354K probably damaging Het
Slc34a2 T C 5: 53,069,134 L533P probably damaging Het
Taf2 G A 15: 55,064,630 L126F probably damaging Het
Tlr12 T C 4: 128,617,992 D155G probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Zfp942 T G 17: 21,929,062 K195N probably benign Het
Other mutations in Doc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0241:Doc2b UTSW 11 75772561 missense probably damaging 1.00
R0241:Doc2b UTSW 11 75772561 missense probably damaging 1.00
R0567:Doc2b UTSW 11 75780124 missense probably damaging 1.00
R1430:Doc2b UTSW 11 75780155 missense possibly damaging 0.80
R1539:Doc2b UTSW 11 75771957 missense probably damaging 1.00
R5109:Doc2b UTSW 11 75777141 missense probably benign 0.00
R5260:Doc2b UTSW 11 75786163 missense probably damaging 1.00
R5443:Doc2b UTSW 11 75780095 missense probably damaging 1.00
R5605:Doc2b UTSW 11 75771960 missense probably damaging 0.99
R5789:Doc2b UTSW 11 75786115 missense probably damaging 1.00
R5805:Doc2b UTSW 11 75772538 missense probably damaging 1.00
R6028:Doc2b UTSW 11 75772586 missense probably benign 0.04
R6146:Doc2b UTSW 11 75773595 missense probably damaging 1.00
R6295:Doc2b UTSW 11 75780267 missense probably damaging 0.99
R6295:Doc2b UTSW 11 75795625 missense probably benign 0.09
Z1176:Doc2b UTSW 11 75777072 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAGATAACTATTCCCTCTCCCACTG -3'
(R):5'- AGCCTCACTGTCTGCTTAGC -3'

Sequencing Primer
(F):5'- GAAATGAGACGGCTTTGCTTAACCC -3'
(R):5'- CTCACTGTCTGCTTAGCTAGGAAG -3'
Posted On2018-06-22