Incidental Mutation 'R6571:Papss2'
ID526343
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 2
SynonymsSk2, Atpsk2, 1810018P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6571 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location32620005-32667187 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 32651942 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
Predicted Effect probably null
Transcript: ENSMUST00000025833
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,692,982 D394G probably benign Het
9130019O22Rik T C 7: 127,385,138 probably benign Het
Acsl6 A G 11: 54,325,564 I161V possibly damaging Het
Adamts12 T C 15: 11,065,101 F24S probably benign Het
Bche G T 3: 73,701,491 Q201K probably benign Het
Camsap1 A T 2: 25,939,500 D757E possibly damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dab2ip T C 2: 35,712,890 S399P probably damaging Het
Fbxo40 A T 16: 36,969,306 C481S probably damaging Het
Fn1 T A 1: 71,626,190 T923S probably damaging Het
Gm11437 T C 11: 84,156,212 D147G probably benign Het
Gm5592 A G 7: 41,288,575 E427G probably damaging Het
Gm6401 T A 14: 41,965,495 I125F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Inpp4a T C 1: 37,387,758 M600T probably damaging Het
Itgb6 T C 2: 60,628,456 E374G probably damaging Het
Lrba A C 3: 86,360,060 S1686R probably damaging Het
Map3k4 T C 17: 12,242,692 D1200G possibly damaging Het
Mmp25 T C 17: 23,639,896 H227R probably benign Het
Olfr768 A C 10: 129,093,121 N284K probably damaging Het
Rasal2 T A 1: 157,161,179 R718S possibly damaging Het
Rngtt T A 4: 33,379,413 D438E probably damaging Het
S1pr1 A G 3: 115,711,803 S381P possibly damaging Het
Sept8 A G 11: 53,537,163 E268G probably damaging Het
Slc6a21 A G 7: 45,280,879 K234R probably damaging Het
Smg1 A G 7: 118,184,514 probably benign Het
Sntg1 T C 1: 8,363,528 probably benign Het
Spag5 G T 11: 78,321,269 R1041I probably damaging Het
Spata31d1b A T 13: 59,717,455 M806L probably benign Het
Tnfrsf18 T A 4: 156,028,319 L154* probably null Het
Trib2 T C 12: 15,794,059 E194G probably damaging Het
Vmn2r33 A G 7: 7,563,669 V148A probably benign Het
Wiz G A 17: 32,359,324 R405W probably damaging Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32638258 missense probably damaging 1.00
IGL01646:Papss2 APN 19 32652082 missense probably benign
IGL02052:Papss2 APN 19 32660583 missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32634004 splice site probably benign
R0091:Papss2 UTSW 19 32633902 missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32638368 nonsense probably null
R0708:Papss2 UTSW 19 32637216 missense probably damaging 0.97
R1336:Papss2 UTSW 19 32638315 missense possibly damaging 0.73
R1488:Papss2 UTSW 19 32637090 missense probably benign 0.02
R1931:Papss2 UTSW 19 32638968 nonsense probably null
R4025:Papss2 UTSW 19 32651923 missense probably damaging 0.98
R4369:Papss2 UTSW 19 32641391 missense probably damaging 1.00
R4762:Papss2 UTSW 19 32638978 missense probably benign 0.05
R5235:Papss2 UTSW 19 32639219 missense probably benign 0.00
R5294:Papss2 UTSW 19 32639000 missense probably benign 0.03
R5320:Papss2 UTSW 19 32638387 missense probably damaging 1.00
R5721:Papss2 UTSW 19 32660664 missense probably damaging 1.00
R5768:Papss2 UTSW 19 32660719 splice site probably null
R5982:Papss2 UTSW 19 32639236 missense probably benign
R6124:Papss2 UTSW 19 32637128 missense probably damaging 1.00
R6395:Papss2 UTSW 19 32664476 missense probably damaging 1.00
R6546:Papss2 UTSW 19 32663148 missense possibly damaging 0.78
R7055:Papss2 UTSW 19 32664427 missense probably damaging 1.00
R7315:Papss2 UTSW 19 32639225 missense possibly damaging 0.60
R7726:Papss2 UTSW 19 32634003 splice site probably null
R7753:Papss2 UTSW 19 32620179 missense probably benign 0.00
R7991:Papss2 UTSW 19 32652003 missense possibly damaging 0.93
R8155:Papss2 UTSW 19 32641342 missense probably benign 0.24
R8275:Papss2 UTSW 19 32638360 missense probably damaging 1.00
X0028:Papss2 UTSW 19 32638395 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCAGCCTGTCTCTGTTGGC -3'
(R):5'- GTGTACCTCCCTACCCCAAA -3'

Sequencing Primer
(F):5'- CCTTGGGTCAGAAGAGGCTTG -3'
(R):5'- CTTGCAAAGGTTTTGTACTTACTTTG -3'
Posted On2018-06-22