Incidental Mutation 'R6576:Ripk2'
ID526361
Institutional Source Beutler Lab
Gene Symbol Ripk2
Ensembl Gene ENSMUSG00000041135
Gene Namereceptor (TNFRSF)-interacting serine-threonine kinase 2
SynonymsCCK, RICK, CARD3, D4Bwg0615e, 2210420D18Rik, RIP2, CARDIAK
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_138952.3; MGI:1891456

Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6576 (G1)
Quality Score192.009
Status Not validated
Chromosome4
Chromosomal Location16122733-16163647 bp(-) (GRCm38)
Type of Mutationintron (1219 bp from exon)
DNA Base Change (assembly) A to T at 16131558 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037035] [ENSMUST00000183871]
Predicted Effect probably null
Transcript: ENSMUST00000037035
SMART Domains Protein: ENSMUSP00000038833
Gene: ENSMUSG00000041135

DomainStartEndE-ValueType
Pfam:Pkinase 18 289 2.1e-43 PFAM
Pfam:Pkinase_Tyr 18 290 1.1e-45 PFAM
CARD 434 522 2.34e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175054
Predicted Effect probably benign
Transcript: ENSMUST00000183871
SMART Domains Protein: ENSMUSP00000139381
Gene: ENSMUSG00000041135

DomainStartEndE-ValueType
Pfam:Pkinase 18 290 5.6e-46 PFAM
Pfam:Pkinase_Tyr 18 290 1.2e-44 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 92% (34/37)
MGI Phenotype Strain: 3622328; 2660793;2446070
FUNCTION: This gene encodes a member of the receptor-interacting protein family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain, and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of nuclear factor kappa B and inducer of apoptosis in response to various stimuli. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to impaired cytokine production in response to LPS treatment, and may result in resistance to LPS-induced septic shock and defects in Toll-like receptor and T-cell receptor signaling. Macrophages homozygous for a knock-in allele show normal LPS signaling. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,532,605 T102S possibly damaging Het
Aff4 C A 11: 53,400,441 H743N probably damaging Het
Apba3 A G 10: 81,273,091 T563A probably benign Het
Arhgap20 T C 9: 51,849,278 S774P probably benign Het
Asap2 A G 12: 21,244,703 Y528C probably damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Ces1b T A 8: 93,056,919 T558S probably benign Het
Chd8 T C 14: 52,216,076 Y1176C probably damaging Het
Cldn15 A T 5: 136,974,616 E157D probably damaging Het
Col4a3 T A 1: 82,708,574 probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dnaaf3 A G 7: 4,523,380 I566T probably benign Het
Drc7 A T 8: 95,075,258 I716F probably damaging Het
Epp13 G A 7: 6,277,542 probably benign Het
Fam35a T C 14: 34,268,242 T236A probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fat4 T C 3: 38,979,690 I2497T probably benign Het
Fmo6 A G 1: 162,922,695 F264S probably damaging Het
Gtf2i T C 5: 134,263,702 D356G probably damaging Het
Id1 T C 2: 152,736,663 V108A probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Klc3 G T 7: 19,397,980 D157E possibly damaging Het
Lasp1 C T 11: 97,833,576 R94C probably damaging Het
Lmbr1 A T 5: 29,291,310 M93K probably damaging Het
Lrrc75a G A 11: 62,605,869 P289L probably damaging Het
Med11 G T 11: 70,453,170 K105N probably benign Het
Mrgprx2 A T 7: 48,482,632 I146N probably damaging Het
Mrpl20 A G 4: 155,806,914 I69V probably benign Het
Pik3c3 A G 18: 30,342,741 probably benign Het
Rad54b T A 4: 11,601,577 N377K probably benign Het
Rilp A G 11: 75,512,392 probably null Het
Rnf167 A C 11: 70,649,762 K156T possibly damaging Het
Snx29 T C 16: 11,715,056 probably null Het
Sox6 T A 7: 115,701,702 I177F probably damaging Het
Tln1 A T 4: 43,555,419 probably null Het
Unc13a T A 8: 71,653,478 T661S probably benign Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r87 G A 10: 130,478,785 L311F probably benign Het
Wdr64 G T 1: 175,805,928 S915I possibly damaging Het
Xpo5 T A 17: 46,240,808 probably null Het
Zswim8 T C 14: 20,721,874 V1548A probably benign Het
Other mutations in Ripk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Ripk2 APN 4 16139198 splice site probably benign
IGL01346:Ripk2 APN 4 16132775 critical splice donor site probably null
IGL01631:Ripk2 APN 4 16163342 missense possibly damaging 0.83
IGL02151:Ripk2 APN 4 16139240 missense possibly damaging 0.83
IGL03093:Ripk2 APN 4 16152056 missense probably damaging 1.00
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0189:Ripk2 UTSW 4 16129125 intron probably null
R1454:Ripk2 UTSW 4 16163239 missense probably damaging 0.96
R1715:Ripk2 UTSW 4 16155192 critical splice acceptor site probably null
R2153:Ripk2 UTSW 4 16132775 critical splice donor site probably null
R2266:Ripk2 UTSW 4 16152011 missense possibly damaging 0.91
R2394:Ripk2 UTSW 4 16132774 splice site probably benign
R3693:Ripk2 UTSW 4 16127695 missense probably benign
R4412:Ripk2 UTSW 4 16124511 missense probably benign
R4463:Ripk2 UTSW 4 16151968 missense possibly damaging 0.70
R4843:Ripk2 UTSW 4 16155073 missense probably damaging 0.99
R5085:Ripk2 UTSW 4 16127663 missense possibly damaging 0.78
R5453:Ripk2 UTSW 4 16151989 missense probably damaging 1.00
R6197:Ripk2 UTSW 4 16163330 missense probably damaging 1.00
R6967:Ripk2 UTSW 4 16158275 critical splice donor site probably null
R7351:Ripk2 UTSW 4 16155048 missense probably damaging 1.00
R7479:Ripk2 UTSW 4 16155154 missense probably benign 0.02
R7718:Ripk2 UTSW 4 16151968 missense possibly damaging 0.70
Predicted Primers
Posted On2018-06-25