Mutagenetix > Incidental Mutation

Incidental Mutation 'R6576:Tln1'

526362

Institutional Source

Beutler Lab

Gene Symbol

Tln1

Ensembl Gene

ENSMUSG00000028465

Gene Name

talin 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6576 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43531519-43562691 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 43555419 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000130353]

AlphaFold

P26039

Predicted Effect

probably null
Transcript: ENSMUST00000030187

SMART Domains

Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465

Domain	Start	End	E-Value	Type
Blast:B41	2	76	5e-31	BLAST
B41	82	313	4.66e-73	SMART
IRS	308	401	7.65e-16	SMART
Pfam:Talin_middle	491	652	8.2e-60	PFAM
low complexity region	671	690	N/A	INTRINSIC
internal_repeat_2	699	760	8.94e-6	PROSPERO
low complexity region	766	775	N/A	INTRINSIC
PDB:1ZVZ\|B	820	844	2e-7	PDB
low complexity region	866	879	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
PDB:2LQG\|A	913	1044	2e-44	PDB
PDB:2L7N\|A	1046	1207	1e-101	PDB
Pfam:VBS	1234	1358	9.6e-8	PFAM
internal_repeat_2	1488	1549	8.94e-6	PROSPERO
internal_repeat_3	1623	1769	4.92e-5	PROSPERO
low complexity region	1817	1828	N/A	INTRINSIC
Pfam:VBS	1849	1973	6.2e-67	PFAM
PDB:3DYJ\|B	1974	2293	N/A	PDB
low complexity region	2305	2327	N/A	INTRINSIC
ILWEQ	2336	2533	2.93e-105	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123985

Predicted Effect

probably benign
Transcript: ENSMUST00000125509

SMART Domains

Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

Domain	Start	End	E-Value	Type
Blast:IRS	2	28	2e-9	BLAST
PDB:2G35\|A	2	29	3e-11	PDB
Pfam:Talin_middle	32	193	1.8e-61	PFAM
PDB:2L7A\|A	215	279	1e-38	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127262

Predicted Effect

probably null
Transcript: ENSMUST00000130353

SMART Domains

Protein: ENSMUSP00000119441
Gene: ENSMUSG00000028465

Domain	Start	End	E-Value	Type
Blast:B41	1	39	9e-7	BLAST
B41	82	241	6.58e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130670

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

92% (34/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	T	4: 62,532,605	T102S	possibly damaging	Het
Aff4	C	A	11: 53,400,441	H743N	probably damaging	Het
Apba3	A	G	10: 81,273,091	T563A	probably benign	Het
Arhgap20	T	C	9: 51,849,278	S774P	probably benign	Het
Asap2	A	G	12: 21,244,703	Y528C	probably damaging	Het
Cep162	A	G	9: 87,217,145	S767P	probably benign	Het
Ces1b	T	A	8: 93,056,919	T558S	probably benign	Het
Chd8	T	C	14: 52,216,076	Y1176C	probably damaging	Het
Cldn15	A	T	5: 136,974,616	E157D	probably damaging	Het
Col4a3	T	A	1: 82,708,574		probably null	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Dnaaf3	A	G	7: 4,523,380	I566T	probably benign	Het
Drc7	A	T	8: 95,075,258	I716F	probably damaging	Het
Epp13	G	A	7: 6,277,542		probably benign	Het
Fam35a	T	C	14: 34,268,242	T236A	probably damaging	Het
Fat3	G	A	9: 16,377,210	T339I	probably damaging	Het
Fat4	T	C	3: 38,979,690	I2497T	probably benign	Het
Fmo6	A	G	1: 162,922,695	F264S	probably damaging	Het
Gtf2i	T	C	5: 134,263,702	D356G	probably damaging	Het
Id1	T	C	2: 152,736,663	V108A	probably benign	Het
Kcnq3	T	C	15: 66,025,178	D291G	possibly damaging	Het
Klc3	G	T	7: 19,397,980	D157E	possibly damaging	Het
Lasp1	C	T	11: 97,833,576	R94C	probably damaging	Het
Lmbr1	A	T	5: 29,291,310	M93K	probably damaging	Het
Lrrc75a	G	A	11: 62,605,869	P289L	probably damaging	Het
Med11	G	T	11: 70,453,170	K105N	probably benign	Het
Mrgprx2	A	T	7: 48,482,632	I146N	probably damaging	Het
Mrpl20	A	G	4: 155,806,914	I69V	probably benign	Het
Pik3c3	A	G	18: 30,342,741		probably benign	Het
Rad54b	T	A	4: 11,601,577	N377K	probably benign	Het
Rilp	A	G	11: 75,512,392		probably null	Het
Ripk2	A	T	4: 16,131,558		probably null	Het
Rnf167	A	C	11: 70,649,762	K156T	possibly damaging	Het
Snx29	T	C	16: 11,715,056		probably null	Het
Sox6	T	A	7: 115,701,702	I177F	probably damaging	Het
Unc13a	T	A	8: 71,653,478	T661S	probably benign	Het
Vmn2r23	A	G	6: 123,733,273	T512A	probably benign	Het
Vmn2r87	G	A	10: 130,478,785	L311F	probably benign	Het
Wdr64	G	T	1: 175,805,928	S915I	possibly damaging	Het
Xpo5	T	A	17: 46,240,808		probably null	Het
Zswim8	T	C	14: 20,721,874	V1548A	probably benign	Het

Other mutations in Tln1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Tln1	APN	4	43542719	missense	probably benign	0.22
IGL00987:Tln1	APN	4	43551297	unclassified	probably benign
IGL01345:Tln1	APN	4	43536281	missense	probably damaging	1.00
IGL01456:Tln1	APN	4	43543432	unclassified	probably benign
IGL01715:Tln1	APN	4	43555890	missense	probably damaging	1.00
IGL01750:Tln1	APN	4	43545435	missense	probably damaging	1.00
IGL01933:Tln1	APN	4	43539508	missense	probably benign
IGL01933:Tln1	APN	4	43555894	missense	possibly damaging	0.52
IGL02119:Tln1	APN	4	43546760	missense	probably damaging	0.99
IGL02148:Tln1	APN	4	43555388	missense	probably damaging	1.00
IGL02153:Tln1	APN	4	43546857	missense	possibly damaging	0.76
IGL02522:Tln1	APN	4	43540612	missense	probably benign	0.07
IGL02691:Tln1	APN	4	43539544	missense	probably benign	0.42
IGL02882:Tln1	APN	4	43539522	missense	probably benign	0.45
IGL02892:Tln1	APN	4	43555679	missense	probably damaging	1.00
IGL03061:Tln1	APN	4	43545694	missense	probably damaging	1.00
IGL03102:Tln1	APN	4	43532861	missense	possibly damaging	0.89
IGL03183:Tln1	APN	4	43539084	splice site	probably benign
H8786:Tln1	UTSW	4	43544589	missense	probably damaging	0.97
PIT4576001:Tln1	UTSW	4	43539998	missense	probably damaging	1.00
PIT4696001:Tln1	UTSW	4	43542701	critical splice donor site	probably null
R0206:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0208:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0454:Tln1	UTSW	4	43553504	missense	probably benign
R0539:Tln1	UTSW	4	43543434	critical splice donor site	probably null
R0548:Tln1	UTSW	4	43542709	missense	possibly damaging	0.79
R0561:Tln1	UTSW	4	43550304	missense	possibly damaging	0.94
R0606:Tln1	UTSW	4	43547756	missense	probably benign	0.34
R0607:Tln1	UTSW	4	43553071	missense	probably damaging	1.00
R0609:Tln1	UTSW	4	43544645	missense	possibly damaging	0.63
R0847:Tln1	UTSW	4	43555333	missense	probably damaging	1.00
R0993:Tln1	UTSW	4	43549825	missense	probably benign	0.22
R1255:Tln1	UTSW	4	43538044	missense	probably damaging	1.00
R1292:Tln1	UTSW	4	43534578	critical splice donor site	probably null
R1752:Tln1	UTSW	4	43536311	missense	probably damaging	1.00
R2169:Tln1	UTSW	4	43548005	missense	probably damaging	1.00
R2172:Tln1	UTSW	4	43545721	missense	probably benign
R2202:Tln1	UTSW	4	43553083	splice site	probably null
R2680:Tln1	UTSW	4	43539668	missense	probably damaging	1.00
R3012:Tln1	UTSW	4	43542525	missense	probably benign
R3714:Tln1	UTSW	4	43540597	missense	probably damaging	1.00
R3735:Tln1	UTSW	4	43549370	missense	probably damaging	0.97
R3794:Tln1	UTSW	4	43536295	missense	probably damaging	1.00
R3825:Tln1	UTSW	4	43536413	splice site	probably benign
R3983:Tln1	UTSW	4	43553030	missense	probably damaging	1.00
R4061:Tln1	UTSW	4	43549177	missense	probably damaging	1.00
R4249:Tln1	UTSW	4	43536104	missense	probably damaging	1.00
R4287:Tln1	UTSW	4	43543509	missense	probably benign	0.01
R4471:Tln1	UTSW	4	43551018	missense	probably benign	0.03
R4562:Tln1	UTSW	4	43533598	missense	probably damaging	1.00
R4654:Tln1	UTSW	4	43535954	missense	probably null	1.00
R4737:Tln1	UTSW	4	43540588	missense	probably benign	0.00
R4936:Tln1	UTSW	4	43547522	missense	possibly damaging	0.83
R5225:Tln1	UTSW	4	43539406	missense	probably benign	0.06
R5288:Tln1	UTSW	4	43540661	missense	probably benign	0.06
R5421:Tln1	UTSW	4	43533609	missense	possibly damaging	0.80
R5445:Tln1	UTSW	4	43543905	missense	probably benign	0.26
R5660:Tln1	UTSW	4	43547732	missense	probably damaging	1.00
R5772:Tln1	UTSW	4	43545191	missense	probably benign	0.13
R6012:Tln1	UTSW	4	43539508	missense	probably benign
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6052:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6145:Tln1	UTSW	4	43538030	missense	possibly damaging	0.64
R6157:Tln1	UTSW	4	43534744	missense	probably benign	0.06
R6242:Tln1	UTSW	4	43533145	missense	probably damaging	1.00
R6454:Tln1	UTSW	4	43533866	missense	probably damaging	0.99
R6467:Tln1	UTSW	4	43543165	missense	probably benign	0.42
R6548:Tln1	UTSW	4	43547525	missense	probably damaging	0.98
R6722:Tln1	UTSW	4	43547618	missense	probably damaging	1.00
R6968:Tln1	UTSW	4	43550217	missense	probably benign	0.02
R7000:Tln1	UTSW	4	43556302	missense	probably damaging	0.96
R7137:Tln1	UTSW	4	43540616	missense	probably damaging	1.00
R7242:Tln1	UTSW	4	43542602	missense	probably benign	0.01
R7294:Tln1	UTSW	4	43534399	missense	probably benign	0.02
R7312:Tln1	UTSW	4	43545922	missense	probably damaging	1.00
R7547:Tln1	UTSW	4	43545206	missense	possibly damaging	0.80
R7836:Tln1	UTSW	4	43554309	missense	probably benign	0.01
R7874:Tln1	UTSW	4	43538041	missense	probably damaging	1.00
R7874:Tln1	UTSW	4	43555606	missense	probably damaging	1.00
R8030:Tln1	UTSW	4	43535737	critical splice donor site	probably null
R8105:Tln1	UTSW	4	43538231	missense	probably benign	0.32
R8212:Tln1	UTSW	4	43555918	missense	probably damaging	1.00
R8416:Tln1	UTSW	4	43540116	missense	probably benign	0.01
R8419:Tln1	UTSW	4	43536397	missense	probably damaging	1.00
R8680:Tln1	UTSW	4	43553041	missense	possibly damaging	0.52
R8708:Tln1	UTSW	4	43534769	splice site	probably benign
R8725:Tln1	UTSW	4	43555911	missense	possibly damaging	0.94
R8727:Tln1	UTSW	4	43555911	missense	possibly damaging	0.94
R8830:Tln1	UTSW	4	43556383	missense	probably benign
R8865:Tln1	UTSW	4	43538281	missense	possibly damaging	0.93
R9049:Tln1	UTSW	4	43549786	nonsense	probably null
R9050:Tln1	UTSW	4	43549786	nonsense	probably null
R9145:Tln1	UTSW	4	43536024	missense	probably damaging	1.00
R9210:Tln1	UTSW	4	43536119	missense	probably damaging	1.00
R9337:Tln1	UTSW	4	43532927	missense	probably damaging	1.00
R9346:Tln1	UTSW	4	43546895	missense	probably damaging	0.97
R9358:Tln1	UTSW	4	43532084	missense	possibly damaging	0.68
R9487:Tln1	UTSW	4	43542893	missense	probably damaging	1.00
R9631:Tln1	UTSW	4	43545694	missense	probably damaging	1.00
R9650:Tln1	UTSW	4	43545912	missense	probably damaging	1.00
R9666:Tln1	UTSW	4	43542957	missense	probably damaging	0.96
RF021:Tln1	UTSW	4	43555890	missense	probably damaging	1.00
X0052:Tln1	UTSW	4	43533125	critical splice donor site	probably null
X0063:Tln1	UTSW	4	43548015	nonsense	probably null
Z1176:Tln1	UTSW	4	43543211	missense	probably benign	0.31

Predicted Primers

Posted On

2018-06-25