Incidental Mutation 'R6577:Lmln'
ID526368
Institutional Source Beutler Lab
Gene Symbol Lmln
Ensembl Gene ENSMUSG00000022802
Gene Nameleishmanolysin-like (metallopeptidase M8 family)
Synonyms5330415H22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6577 (G1)
Quality Score119.008
Status Not validated
Chromosome16
Chromosomal Location33062521-33127695 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 33107000 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023497] [ENSMUST00000023497] [ENSMUST00000023497]
Predicted Effect probably null
Transcript: ENSMUST00000023497
SMART Domains Protein: ENSMUSP00000023497
Gene: ENSMUSG00000022802

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Peptidase_M8 154 289 3.9e-16 PFAM
Pfam:Peptidase_M8 295 633 5.2e-54 PFAM
transmembrane domain 658 680 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023497
SMART Domains Protein: ENSMUSP00000023497
Gene: ENSMUSG00000022802

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Peptidase_M8 154 289 3.9e-16 PFAM
Pfam:Peptidase_M8 295 633 5.2e-54 PFAM
transmembrane domain 658 680 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023497
SMART Domains Protein: ENSMUSP00000023497
Gene: ENSMUSG00000022802

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Peptidase_M8 154 289 3.9e-16 PFAM
Pfam:Peptidase_M8 295 633 5.2e-54 PFAM
transmembrane domain 658 680 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158235
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-metallopeptidase. The encoded protein may play a role in cell migration and invasion. Studies of a similar protein in Drosophila indicate a potential role in mitotic progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,653,159 T285A probably benign Het
Api5 T C 2: 94,422,381 Y348C probably benign Het
Arl14 A G 3: 69,223,072 E184G probably benign Het
Asap3 T C 4: 136,238,230 probably null Het
Atp11b T A 3: 35,839,162 V36E probably damaging Het
Atp13a4 C T 16: 29,479,841 S100N probably benign Het
C530008M17Rik A T 5: 76,866,100 probably benign Het
Cd27 T C 6: 125,236,793 T34A probably benign Het
Clec10a T C 11: 70,170,610 S274P probably benign Het
Cntnap2 C T 6: 46,170,272 T484I probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Def8 T C 8: 123,456,710 S304P probably benign Het
Dgkd G A 1: 87,940,240 V299M probably damaging Het
Ephb2 T C 4: 136,657,550 D850G probably damaging Het
Gjc1 T C 11: 102,800,304 N291S possibly damaging Het
Hc T C 2: 35,032,126 I563V probably benign Het
Hells C T 19: 38,931,465 Q20* probably null Het
Hid1 G C 11: 115,354,636 P448A possibly damaging Het
Igkv8-24 C T 6: 70,216,963 R87H possibly damaging Het
Irf6 A G 1: 193,169,354 S418G probably damaging Het
Kcnv2 T A 19: 27,324,020 C424S possibly damaging Het
Myo1a A T 10: 127,715,320 I678F possibly damaging Het
Nup98 A C 7: 102,128,846 probably null Het
Papolg GGACTTGGGATACTTACGCTTTG GG 11: 23,879,857 probably benign Het
Ppfibp1 T A 6: 146,999,655 probably null Het
Sardh T C 2: 27,218,855 T623A possibly damaging Het
Scml4 A G 10: 42,947,111 N251D probably damaging Het
Skap1 T C 11: 96,526,044 Y52H probably damaging Het
Srp68 G A 11: 116,265,464 R113W probably damaging Het
Srsf12 T C 4: 33,209,196 probably benign Het
Stat5b A G 11: 100,797,700 M312T probably benign Het
Tma7 T C 9: 109,082,194 probably benign Het
Tmem120b T G 5: 123,116,647 F304V probably damaging Het
Tns3 G A 11: 8,549,057 L9F probably damaging Het
Tns3 G T 11: 8,549,058 D8E probably damaging Het
Tsc2 C T 17: 24,610,499 A765T probably damaging Het
Uba1y A G Y: 825,465 I276V probably benign Homo
Upb1 T G 10: 75,412,889 L81R probably damaging Het
Uros C A 7: 133,700,840 C73F probably damaging Het
Zcchc6 C T 13: 59,808,161 C45Y probably damaging Het
Zfp820 T C 17: 21,819,403 I315V probably benign Het
Other mutations in Lmln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Lmln APN 16 33083065 missense probably benign 0.08
IGL01346:Lmln APN 16 33117120 missense probably benign 0.00
IGL01664:Lmln APN 16 33080987 missense probably benign 0.03
nemeth UTSW 16 33074097 nonsense probably null
R0234:Lmln UTSW 16 33066324 missense probably damaging 0.99
R0234:Lmln UTSW 16 33066324 missense probably damaging 0.99
R0562:Lmln UTSW 16 33117085 nonsense probably null
R1017:Lmln UTSW 16 33088176 missense probably benign
R1557:Lmln UTSW 16 33088211 missense probably benign 0.25
R1617:Lmln UTSW 16 33117130 missense probably damaging 1.00
R2211:Lmln UTSW 16 33109778 missense probably benign 0.00
R4061:Lmln UTSW 16 33066391 nonsense probably null
R4414:Lmln UTSW 16 33109850 missense probably benign 0.00
R4512:Lmln UTSW 16 33088137 missense probably benign 0.01
R4564:Lmln UTSW 16 33109856 missense probably benign 0.09
R4995:Lmln UTSW 16 33074097 nonsense probably null
R5044:Lmln UTSW 16 33074180 missense possibly damaging 0.80
R6109:Lmln UTSW 16 33069111 missense possibly damaging 0.69
R6287:Lmln UTSW 16 33074185 critical splice donor site probably null
R6689:Lmln UTSW 16 33104782 missense probably benign 0.19
R7079:Lmln UTSW 16 33067291 missense probably benign 0.02
R7432:Lmln UTSW 16 33089368 missense probably damaging 1.00
R7807:Lmln UTSW 16 33107131 missense probably benign 0.04
Predicted Primers
Posted On2018-06-25