Incidental Mutation 'R6608:Aox1'
ID526408
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58057546 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 267 (Y267H)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably benign
Transcript: ENSMUST00000001027
AA Change: Y267H

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: Y267H

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160168
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5652:Aox1 UTSW 1 58095197 missense probably damaging 1.00
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGAATTTTGTCACAAGCTCTCTC -3'
(R):5'- GCCAGTGTGGTACCCAAATG -3'

Sequencing Primer
(F):5'- ACAAGCTCTCTCAAATCCCTGTTG -3'
(R):5'- AGGATACCTGTACCCTGATGCTG -3'
Posted On2018-06-25