Incidental Mutation 'R6608:Olfr430'
ID526409
Institutional Source Beutler Lab
Gene Symbol Olfr430
Ensembl Gene ENSMUSG00000050134
Gene Nameolfactory receptor 430
SynonymsGA_x6K02T2P20D-21108443-21107490, MOR105-5P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174066605-174072273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174069729 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 144 (M144V)
Ref Sequence ENSEMBL: ENSMUSP00000150930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055873] [ENSMUST00000213425] [ENSMUST00000214390]
Predicted Effect probably benign
Transcript: ENSMUST00000055873
AA Change: M144V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130615
Gene: ENSMUSG00000050134
AA Change: M144V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-65 PFAM
Pfam:7tm_1 41 290 9.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213425
AA Change: M144V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000214390
AA Change: M144V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Olfr430
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Olfr430 APN 1 174070066 missense probably benign 0.00
IGL02279:Olfr430 APN 1 174069391 missense probably null 1.00
IGL02537:Olfr430 APN 1 174069454 missense possibly damaging 0.63
R0323:Olfr430 UTSW 1 174069327 missense probably benign
R0627:Olfr430 UTSW 1 174070077 missense probably damaging 1.00
R1079:Olfr430 UTSW 1 174069466 missense possibly damaging 0.95
R1757:Olfr430 UTSW 1 174069658 missense probably damaging 1.00
R1902:Olfr430 UTSW 1 174070126 missense probably damaging 0.96
R3804:Olfr430 UTSW 1 174069908 missense probably damaging 1.00
R3927:Olfr430 UTSW 1 174069312 missense probably damaging 1.00
R3930:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R3931:Olfr430 UTSW 1 174069581 missense probably damaging 1.00
R4111:Olfr430 UTSW 1 174069433 missense probably damaging 1.00
R4210:Olfr430 UTSW 1 174070008 missense probably damaging 0.98
R4383:Olfr430 UTSW 1 174069477 missense probably benign 0.34
R4651:Olfr430 UTSW 1 174069828 missense possibly damaging 0.54
R5097:Olfr430 UTSW 1 174069529 missense probably benign 0.22
R5385:Olfr430 UTSW 1 174069470 missense probably benign 0.31
R5722:Olfr430 UTSW 1 174069870 missense probably damaging 1.00
R6643:Olfr430 UTSW 1 174070045 missense probably damaging 1.00
R7316:Olfr430 UTSW 1 174070161 missense probably benign 0.00
R7532:Olfr430 UTSW 1 174070098 missense probably benign 0.37
Z1088:Olfr430 UTSW 1 174069949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTTATGGTATACAGCCACC -3'
(R):5'- AGGCATTGACAGCAAAGTCC -3'

Sequencing Primer
(F):5'- GATGCTAGCTAATCTTCTCAGTGAG -3'
(R):5'- CCACCAGAACATTAGTGGATGTGTC -3'
Posted On2018-06-25