Incidental Mutation 'R6608:Man1b1'
ID526410
Institutional Source Beutler Lab
Gene Symbol Man1b1
Ensembl Gene ENSMUSG00000036646
Gene Namemannosidase, alpha, class 1B, member 1
SynonymsLOC227619, E430019H13Rik, MANA-ER
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25332338-25352212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25343251 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 212 (V212E)
Ref Sequence ENSEMBL: ENSMUSP00000036996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042390] [ENSMUST00000136245]
Predicted Effect probably damaging
Transcript: ENSMUST00000042390
AA Change: V212E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036996
Gene: ENSMUSG00000036646
AA Change: V212E

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 29 42 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
Pfam:Glyco_hydro_47 215 654 9.5e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131826
Predicted Effect probably damaging
Transcript: ENSMUST00000136245
AA Change: V229E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114989
Gene: ENSMUSG00000036646
AA Change: V229E

DomainStartEndE-ValueType
transmembrane domain 68 87 N/A INTRINSIC
PDB:1X9D|A 145 238 9e-21 PDB
SCOP:d1fo3a_ 217 237 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157546
Meta Mutation Damage Score 0.9272 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Man1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Man1b1 APN 2 25343325 missense possibly damaging 0.53
IGL01338:Man1b1 APN 2 25338227 missense probably benign 0.01
IGL01934:Man1b1 APN 2 25345511 missense probably benign 0.00
IGL03063:Man1b1 APN 2 25334404 missense possibly damaging 0.48
IGL03067:Man1b1 APN 2 25349332 missense probably benign
canebrake UTSW 2 25343353 missense probably damaging 1.00
sugarcane UTSW 2 25343251 missense probably damaging 1.00
PIT4520001:Man1b1 UTSW 2 25343270 missense probably damaging 1.00
R0731:Man1b1 UTSW 2 25338155 missense possibly damaging 0.87
R1716:Man1b1 UTSW 2 25345020 missense probably benign 0.14
R4470:Man1b1 UTSW 2 25332855 intron probably benign
R4472:Man1b1 UTSW 2 25332855 intron probably benign
R4838:Man1b1 UTSW 2 25345475 missense possibly damaging 0.79
R4953:Man1b1 UTSW 2 25338184 missense probably damaging 0.99
R5162:Man1b1 UTSW 2 25343353 missense probably damaging 1.00
R5861:Man1b1 UTSW 2 25348054 missense probably benign 0.01
R7098:Man1b1 UTSW 2 25338184 missense probably damaging 0.99
R7215:Man1b1 UTSW 2 25350390 missense probably benign 0.00
Z1176:Man1b1 UTSW 2 25344983 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTCTAACCTGTGCTTTGGCC -3'
(R):5'- CACATGCTGCTTCGGCTTAC -3'

Sequencing Primer
(F):5'- TAACCTGTGCTTTGGCCTCCTG -3'
(R):5'- ACACATGGAAACCCAGTCC -3'
Posted On2018-06-25