Incidental Mutation 'R6608:Olfr1168'
ID526412
Institutional Source Beutler Lab
Gene Symbol Olfr1168
Ensembl Gene ENSMUSG00000061342
Gene Nameolfactory receptor 1168
SynonymsMOR174-13, GA_x6K02T2Q125-49669483-49670421
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88181880-88186919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88185705 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 276 (Y276C)
Ref Sequence ENSEMBL: ENSMUSP00000149517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079599] [ENSMUST00000215996]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079599
AA Change: Y276C

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078549
Gene: ENSMUSG00000061342
AA Change: Y276C

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215996
AA Change: Y276C

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Olfr1168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Olfr1168 APN 2 88185285 missense probably benign 0.05
R0079:Olfr1168 UTSW 2 88185354 missense possibly damaging 0.94
R0302:Olfr1168 UTSW 2 88185510 missense possibly damaging 0.95
R0606:Olfr1168 UTSW 2 88185280 missense possibly damaging 0.70
R0973:Olfr1168 UTSW 2 88184978 missense probably benign 0.07
R0973:Olfr1168 UTSW 2 88184978 missense probably benign 0.07
R0974:Olfr1168 UTSW 2 88184978 missense probably benign 0.07
R2140:Olfr1168 UTSW 2 88185095 missense probably benign 0.14
R2261:Olfr1168 UTSW 2 88185621 missense probably damaging 1.00
R5235:Olfr1168 UTSW 2 88185568 missense probably benign
R7323:Olfr1168 UTSW 2 88185608 missense possibly damaging 0.90
R7476:Olfr1168 UTSW 2 88184966 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTTGTCACAATCATCAAGATGC -3'
(R):5'- TGAGCTTGAATCAGAGTACAGAAC -3'

Sequencing Primer
(F):5'- GATGCCTTCTAAAGATGGACTCAG -3'
(R):5'- GCTTGAATCAGAGTACAGAACATTTG -3'
Posted On2018-06-25