Incidental Mutation 'R6608:Rnf20'
ID 526415
Institutional Source Beutler Lab
Gene Symbol Rnf20
Ensembl Gene ENSMUSG00000028309
Gene Name ring finger protein 20
Synonyms 4833430L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6608 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 49632006-49656887 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 49650051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 540 (S540F)
Ref Sequence ENSEMBL: ENSMUSP00000118293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000156314] [ENSMUST00000167496]
AlphaFold Q5DTM8
Predicted Effect probably benign
Transcript: ENSMUST00000029989
AA Change: S540F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: S540F

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149862
Predicted Effect probably benign
Transcript: ENSMUST00000156314
AA Change: S540F

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: S540F

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
SCOP:d1gw5a_ 174 294 3e-3 SMART
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167496
AA Change: S540F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: S540F

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Rnf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rnf20 APN 4 49655480 nonsense probably null
IGL01319:Rnf20 APN 4 49649326 missense probably damaging 0.99
IGL01666:Rnf20 APN 4 49654486 nonsense probably null
IGL01975:Rnf20 APN 4 49654473 missense probably benign 0.00
IGL02130:Rnf20 APN 4 49644481 splice site probably benign
IGL02179:Rnf20 APN 4 49638712 missense probably benign 0.04
IGL03096:Rnf20 APN 4 49638615 splice site probably benign
IGL03120:Rnf20 APN 4 49649955 splice site probably benign
IGL03208:Rnf20 APN 4 49645706 splice site probably benign
IGL03257:Rnf20 APN 4 49645687 missense probably benign 0.19
IGL03349:Rnf20 APN 4 49655936 missense probably damaging 1.00
R0372:Rnf20 UTSW 4 49650176 missense possibly damaging 0.53
R0486:Rnf20 UTSW 4 49645907 missense possibly damaging 0.57
R0791:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R0927:Rnf20 UTSW 4 49642176 missense probably damaging 1.00
R1256:Rnf20 UTSW 4 49638230 missense probably benign 0.33
R1272:Rnf20 UTSW 4 49651496 missense probably damaging 0.99
R1460:Rnf20 UTSW 4 49645873 splice site probably benign
R1522:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R1698:Rnf20 UTSW 4 49651498 nonsense probably null
R1848:Rnf20 UTSW 4 49644628 missense probably damaging 1.00
R2214:Rnf20 UTSW 4 49648344 missense possibly damaging 0.77
R2497:Rnf20 UTSW 4 49652676 splice site probably null
R2915:Rnf20 UTSW 4 49638769 missense probably benign 0.13
R4726:Rnf20 UTSW 4 49654579 nonsense probably null
R4770:Rnf20 UTSW 4 49633412 critical splice donor site probably null
R4799:Rnf20 UTSW 4 49649962 critical splice acceptor site probably null
R4960:Rnf20 UTSW 4 49638029 missense probably damaging 0.99
R5022:Rnf20 UTSW 4 49642016 intron probably benign
R5146:Rnf20 UTSW 4 49651456 missense probably benign 0.21
R5379:Rnf20 UTSW 4 49652639 missense possibly damaging 0.47
R5423:Rnf20 UTSW 4 49644620 missense probably damaging 0.99
R6297:Rnf20 UTSW 4 49642132 missense probably damaging 1.00
R7064:Rnf20 UTSW 4 49644580 nonsense probably null
R7776:Rnf20 UTSW 4 49644592 nonsense probably null
R8735:Rnf20 UTSW 4 49655964 missense possibly damaging 0.95
R8995:Rnf20 UTSW 4 49648437 missense possibly damaging 0.94
Z1177:Rnf20 UTSW 4 49645655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGCAGTCTGACCTGAACAAG -3'
(R):5'- AAGTTCAATCTTCAGCTGCTTG -3'

Sequencing Primer
(F):5'- CCTGAACAAGGTGACCTGG -3'
(R):5'- TCAGCTGCTTGATAATTTCTGC -3'
Posted On 2018-06-25