Incidental Mutation 'R6608:Tinagl1'
ID526416
Institutional Source Beutler Lab
Gene Symbol Tinagl1
Ensembl Gene ENSMUSG00000028776
Gene Nametubulointerstitial nephritis antigen-like 1
Synonyms1110021J17Rik, Lcn7, Arg1, androgen-regulated gene 1, AZ-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location130164454-130175122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130172989 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 105 (M105T)
Ref Sequence ENSEMBL: ENSMUSP00000135453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030560] [ENSMUST00000105998] [ENSMUST00000105999] [ENSMUST00000132545] [ENSMUST00000175992]
Predicted Effect probably benign
Transcript: ENSMUST00000030560
AA Change: M105T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030560
Gene: ENSMUSG00000028776
AA Change: M105T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105998
AA Change: M105T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101620
Gene: ENSMUSG00000028776
AA Change: M105T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105999
AA Change: M105T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101621
Gene: ENSMUSG00000028776
AA Change: M105T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 202 455 2.62e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132545
AA Change: M105T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135453
Gene: ENSMUSG00000028776
AA Change: M105T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175822
Predicted Effect probably benign
Transcript: ENSMUST00000175992
AA Change: M105T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134900
Gene: ENSMUSG00000028776
AA Change: M105T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SO 50 95 2.13e-2 SMART
Pept_C1 171 424 2.62e-62 SMART
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to tubulointerstitial nephritis antigen, a secreted glycoprotein that is recognized by antibodies in some types of immune-related tubulointerstitial nephritis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Female mice homozygous for a null mutation display impaired fertility and homozygous pups born to homozygous females show impaired postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Tinagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01908:Tinagl1 APN 4 130167430 missense probably damaging 1.00
IGL01935:Tinagl1 APN 4 130168001 missense probably damaging 1.00
R0125:Tinagl1 UTSW 4 130166308 missense probably damaging 1.00
R0893:Tinagl1 UTSW 4 130174023 missense probably damaging 1.00
R1731:Tinagl1 UTSW 4 130168049 missense probably benign
R2020:Tinagl1 UTSW 4 130166972 missense probably damaging 1.00
R2264:Tinagl1 UTSW 4 130167433 missense probably benign 0.00
R2281:Tinagl1 UTSW 4 130166993 missense probably damaging 1.00
R4786:Tinagl1 UTSW 4 130173931 missense probably benign 0.21
R5058:Tinagl1 UTSW 4 130167457 missense probably benign
R5908:Tinagl1 UTSW 4 130172970 nonsense probably null
R6247:Tinagl1 UTSW 4 130172932 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAACACTTGAGGCCCAG -3'
(R):5'- AACCCGTGGATGTTCTAGGATG -3'

Sequencing Primer
(F):5'- CACTTGAGGCCCAGAGAAC -3'
(R):5'- AGTTTGTCTCTAGATTTCGTTGGGC -3'
Posted On2018-06-25