Incidental Mutation 'R6608:Clns1a'
ID526420
Institutional Source Beutler Lab
Gene Symbol Clns1a
Ensembl Gene ENSMUSG00000025439
Gene Namechloride channel, nucleotide-sensitive, 1A
SynonymsClci, ICLN, Clcni, 2610100O04Rik, 2610036D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97696634-97720796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97716468 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 226 (T226A)
Ref Sequence ENSEMBL: ENSMUSP00000026506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026506]
Predicted Effect probably benign
Transcript: ENSMUST00000026506
AA Change: T226A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026506
Gene: ENSMUSG00000025439
AA Change: T226A

DomainStartEndE-ValueType
Pfam:Voldacs 40 168 1.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205667
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in multiple regulatory pathways. The encoded protein complexes with numerous cytosolic proteins and performs diverse functions including regulation of small nuclear ribonucleoprotein biosynthesis, platelet activation and cytoskeletal organization. The protein is also found associated with the plasma membrane where it functions as a chloride current regulator. Pseudogenes of this gene are found on chromosomes 1, 4 and 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous mutants die between E3.5-E7.5. Heterozygous mutants appear normal and healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Clns1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Clns1a APN 7 97716514 missense probably damaging 0.99
IGL03209:Clns1a APN 7 97711730 missense probably null 0.05
R0234:Clns1a UTSW 7 97714032 missense possibly damaging 0.93
R0234:Clns1a UTSW 7 97714032 missense possibly damaging 0.93
R1087:Clns1a UTSW 7 97705655 missense possibly damaging 0.63
R1844:Clns1a UTSW 7 97696859 missense probably damaging 0.97
R2119:Clns1a UTSW 7 97713904 splice site probably null
R3797:Clns1a UTSW 7 97696835 missense probably benign 0.00
R4463:Clns1a UTSW 7 97720949 unclassified probably benign
R4810:Clns1a UTSW 7 97714017 missense probably benign 0.10
R5574:Clns1a UTSW 7 97720958 unclassified probably benign
R7051:Clns1a UTSW 7 97712617 splice site probably null
R7384:Clns1a UTSW 7 97696781 missense probably benign 0.00
R8183:Clns1a UTSW 7 97705681 missense probably damaging 1.00
R8770:Clns1a UTSW 7 97713910 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGATGTGATAGGACAGAGCG -3'
(R):5'- TTTCCAGTCACCAGAGATAGGC -3'

Sequencing Primer
(F):5'- CGATTGGGTCTCACATGTAGC -3'
(R):5'- TTCAGGGATCTTCATGTTG -3'
Posted On2018-06-25