Incidental Mutation 'R6608:Adamts18'
ID526425
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
SynonymsE130314N14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location113697126-113848738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113775279 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 317 (Y317N)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
Predicted Effect probably damaging
Transcript: ENSMUST00000093113
AA Change: Y317N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: Y317N

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212527
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213078
Meta Mutation Damage Score 0.9570 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zp1 C T 19: 10,918,980 C127Y possibly damaging Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 113774943 missense probably damaging 1.00
IGL01548:Adamts18 APN 8 113764299 missense probably damaging 1.00
IGL01556:Adamts18 APN 8 113845109 missense probably benign 0.01
IGL01833:Adamts18 APN 8 113743096 missense probably benign 0.10
IGL02187:Adamts18 APN 8 113713194 missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 113699072 missense probably damaging 1.00
IGL02756:Adamts18 APN 8 113714344 splice site probably benign
IGL03188:Adamts18 APN 8 113699024 missense probably damaging 1.00
IGL03411:Adamts18 APN 8 113764297 nonsense probably null
R0119:Adamts18 UTSW 8 113774953 missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 113743117 missense probably damaging 1.00
R0410:Adamts18 UTSW 8 113714358 nonsense probably null
R0480:Adamts18 UTSW 8 113738818 missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 113738769 intron probably null
R0924:Adamts18 UTSW 8 113705396 splice site probably null
R0930:Adamts18 UTSW 8 113705396 splice site probably null
R1333:Adamts18 UTSW 8 113705173 splice site probably benign
R1441:Adamts18 UTSW 8 113754562 critical splice donor site probably null
R2082:Adamts18 UTSW 8 113775333 missense probably damaging 1.00
R2146:Adamts18 UTSW 8 113845003 missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 113705261 missense probably benign 0.36
R3148:Adamts18 UTSW 8 113738858 missense probably damaging 1.00
R3963:Adamts18 UTSW 8 113777811 missense probably benign 0.00
R4056:Adamts18 UTSW 8 113737580 nonsense probably null
R4486:Adamts18 UTSW 8 113713193 missense probably benign 0.00
R4608:Adamts18 UTSW 8 113737613 missense probably damaging 1.00
R4624:Adamts18 UTSW 8 113773168 nonsense probably null
R4626:Adamts18 UTSW 8 113773168 nonsense probably null
R4627:Adamts18 UTSW 8 113773168 nonsense probably null
R4628:Adamts18 UTSW 8 113773168 nonsense probably null
R4629:Adamts18 UTSW 8 113773168 nonsense probably null
R4710:Adamts18 UTSW 8 113706926 missense probably damaging 0.98
R4959:Adamts18 UTSW 8 113736725 nonsense probably null
R4973:Adamts18 UTSW 8 113736725 nonsense probably null
R4976:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5119:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5141:Adamts18 UTSW 8 113775270 missense probably damaging 1.00
R5422:Adamts18 UTSW 8 113698974 missense probably benign 0.06
R5587:Adamts18 UTSW 8 113775360 nonsense probably null
R5868:Adamts18 UTSW 8 113777748 missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 113773077 missense probably damaging 1.00
R5906:Adamts18 UTSW 8 113709619 missense probably benign 0.00
R5942:Adamts18 UTSW 8 113777748 missense probably benign 0.01
R6006:Adamts18 UTSW 8 113706974 missense probably damaging 1.00
R6725:Adamts18 UTSW 8 113743201 missense probably damaging 1.00
R7002:Adamts18 UTSW 8 113775290 missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 113775264 missense probably damaging 0.99
R7292:Adamts18 UTSW 8 113709645 missense probably benign 0.00
R7411:Adamts18 UTSW 8 113777730 missense probably damaging 0.99
R7685:Adamts18 UTSW 8 113713223 missense probably damaging 1.00
R7860:Adamts18 UTSW 8 113775276 missense probably damaging 1.00
R7943:Adamts18 UTSW 8 113775276 missense probably damaging 1.00
Z1088:Adamts18 UTSW 8 113775440 missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 113743168 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGTGTAGGTTTCAATCTTACCAGAC -3'
(R):5'- AGCCTATGTCACCCAGATTTTG -3'

Sequencing Primer
(F):5'- GGTTTCAATCTTACCAGACTCAAAAG -3'
(R):5'- GTCTCTCACAGATGCCCCCAAG -3'
Posted On2018-06-25