Mutagenetix > Incidental Mutations

Incidental Mutation 'R6608:Pcdhb5'

526441

Institutional Source

Beutler Lab

Gene Symbol

Pcdhb5

Ensembl Gene

ENSMUSG00000063687

Gene Name

protocadherin beta 5

Synonyms

Pcdhb4A, PcdhbE

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R6608 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37320381-37323915 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 37321823 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 419 (T419A)

Ref Sequence

ENSEMBL: ENSMUSP00000077389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078271
AA Change: T419A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: T419A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	46	130	1.55e0	SMART
CA	154	239	2.42e-18	SMART
CA	263	344	1.27e-26	SMART
CA	367	448	1.14e-23	SMART
CA	472	558	2.38e-26	SMART
CA	588	669	7.06e-11	SMART
Pfam:Cadherin_C_2	686	769	3.1e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115661

SMART Domains

Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

Domain	Start	End	E-Value	Type
CA	20	131	5.3e-2	SMART
CA	155	240	1.51e-19	SMART
CA	264	348	7.6e-25	SMART
CA	372	453	1.42e-24	SMART
CA	477	563	1.42e-24	SMART
CA	594	674	4.12e-12	SMART
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cadherin_tail	796	930	3.9e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193984

Predicted Effect

probably benign
Transcript: ENSMUST00000194544

SMART Domains

Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

Domain	Start	End	E-Value	Type
Blast:CA	18	66	5e-20	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.2%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	T	C	5: 121,632,492	T571A	probably benign	Het
Adamts18	A	T	8: 113,775,279	Y317N	probably damaging	Het
Adgrg5	T	C	8: 94,941,720	F470S	probably damaging	Het
AK157302	T	C	13: 21,495,624	S107P	probably damaging	Het
Ankrd31	A	G	13: 96,832,780	Y975C	probably damaging	Het
Ankrd37	C	T	8: 45,999,854		probably benign	Het
Aox1	T	C	1: 58,057,546	Y267H	probably benign	Het
Cdan1	A	C	2: 120,726,680	I555R	possibly damaging	Het
Clns1a	A	G	7: 97,716,468	T226A	probably benign	Het
Col18a1	C	T	10: 77,112,794		probably benign	Het
Col5a3	C	A	9: 20,774,019	V1454L	unknown	Het
Coq6	G	A	12: 84,372,148	V309I	probably benign	Het
Decr2	C	T	17: 26,083,884	V173M	probably benign	Het
Dmgdh	G	A	13: 93,706,744	G363S	possibly damaging	Het
Dnah7a	A	T	1: 53,525,118	D1927E	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Epm2a	T	C	10: 11,390,987		probably null	Het
Gm1979	T	A	5: 26,001,096	H162L	probably benign	Het
Knl1	A	G	2: 119,086,612	N1759D	probably damaging	Het
Man1b1	T	A	2: 25,343,251	V212E	probably damaging	Het
Marf1	A	G	16: 14,132,714	L936S	probably damaging	Het
Mki67	G	A	7: 135,698,361	T1648I	probably benign	Het
Mrvi1	A	T	7: 110,888,551	S486T	probably damaging	Het
Olfr1168	A	G	2: 88,185,705	Y276C	possibly damaging	Het
Olfr135	T	C	17: 38,208,479	V78A	probably damaging	Het
Olfr401	T	C	11: 74,121,628	V113A	probably benign	Het
Olfr430	A	G	1: 174,069,729	M144V	probably benign	Het
Parp11	A	G	6: 127,477,848	I110V	possibly damaging	Het
Pitpnm1	A	G	19: 4,110,875	D838G	probably damaging	Het
Rbm26	T	A	14: 105,152,498	N230I	probably damaging	Het
Rnf20	C	T	4: 49,650,051	S540F	probably benign	Het
Rsad1	T	C	11: 94,542,609	D417G	probably damaging	Het
Serpina3c	A	T	12: 104,149,624	N220K	probably benign	Het
Slc6a19	A	G	13: 73,683,972	L495P	probably damaging	Het
Stard7	A	T	2: 127,290,795	K194N	probably damaging	Het
Tinagl1	A	G	4: 130,172,989	M105T	probably benign	Het
Ttn	G	A	2: 76,749,329	T23740M	probably damaging	Het
Tyk2	G	T	9: 21,108,016	Q1014K	probably benign	Het
Usp10	C	T	8: 119,948,422	R461W	probably benign	Het
Wsb1	C	T	11: 79,240,362	E403K	probably benign	Het
Ylpm1	C	G	12: 85,015,277	P651A	unknown	Het
Zp1	C	T	19: 10,918,980	C127Y	possibly damaging	Het
Zzef1	T	A	11: 72,912,826	F2466L	probably damaging	Het

Other mutations in Pcdhb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Pcdhb5	APN	18	37322109	missense	probably damaging	1.00
IGL00895:Pcdhb5	APN	18	37320983	missense	probably benign	0.42
IGL00896:Pcdhb5	APN	18	37322785	splice site	probably null
IGL01385:Pcdhb5	APN	18	37322214	missense	probably benign	0.00
IGL01619:Pcdhb5	APN	18	37322939	missense	probably damaging	1.00
IGL01712:Pcdhb5	APN	18	37321253	missense	probably damaging	1.00
IGL01716:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01719:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01720:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01723:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01724:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01839:Pcdhb5	APN	18	37321449	missense	probably damaging	0.98
IGL01884:Pcdhb5	APN	18	37321334	missense	probably benign	0.00
IGL01962:Pcdhb5	APN	18	37321040	missense	probably damaging	1.00
IGL02088:Pcdhb5	APN	18	37321959	missense	probably benign	0.11
IGL02299:Pcdhb5	APN	18	37320890	missense	probably benign
IGL02444:Pcdhb5	APN	18	37321050	missense	probably benign	0.01
IGL03372:Pcdhb5	APN	18	37320660	missense	probably benign	0.22
R0034:Pcdhb5	UTSW	18	37322084	missense	probably damaging	1.00
R0047:Pcdhb5	UTSW	18	37321268	missense	possibly damaging	0.87
R0179:Pcdhb5	UTSW	18	37322559	missense	probably damaging	1.00
R0466:Pcdhb5	UTSW	18	37322543	missense	probably damaging	1.00
R0471:Pcdhb5	UTSW	18	37321306	nonsense	probably null
R0565:Pcdhb5	UTSW	18	37320767	missense	possibly damaging	0.91
R0646:Pcdhb5	UTSW	18	37321622	missense	probably benign
R1014:Pcdhb5	UTSW	18	37322250	missense	probably damaging	1.00
R1617:Pcdhb5	UTSW	18	37321402	nonsense	probably null
R1676:Pcdhb5	UTSW	18	37320752	missense	probably benign	0.01
R1774:Pcdhb5	UTSW	18	37322672	missense	probably damaging	0.99
R1826:Pcdhb5	UTSW	18	37321469	nonsense	probably null
R1854:Pcdhb5	UTSW	18	37322340	missense	possibly damaging	0.94
R2355:Pcdhb5	UTSW	18	37322116	missense	probably benign
R4290:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4292:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4293:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4294:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4295:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4391:Pcdhb5	UTSW	18	37322736	missense	possibly damaging	0.88
R4411:Pcdhb5	UTSW	18	37321997	missense	possibly damaging	0.80
R4480:Pcdhb5	UTSW	18	37320752	missense	probably benign	0.43
R4852:Pcdhb5	UTSW	18	37322471	missense	probably benign	0.04
R5121:Pcdhb5	UTSW	18	37321117	missense	probably benign	0.11
R5133:Pcdhb5	UTSW	18	37320890	missense	probably benign
R5630:Pcdhb5	UTSW	18	37321155	missense	possibly damaging	0.88
R5833:Pcdhb5	UTSW	18	37321102	missense	probably damaging	0.99
R5896:Pcdhb5	UTSW	18	37322679	nonsense	probably null
R5942:Pcdhb5	UTSW	18	37320785	nonsense	probably null
R5945:Pcdhb5	UTSW	18	37321470	missense	probably benign	0.08
R5970:Pcdhb5	UTSW	18	37321773	missense	probably damaging	1.00
R6045:Pcdhb5	UTSW	18	37321575	missense	probably damaging	1.00
R6054:Pcdhb5	UTSW	18	37321080	missense	probably damaging	0.98
R6147:Pcdhb5	UTSW	18	37320726	missense	probably damaging	1.00
R6152:Pcdhb5	UTSW	18	37322833	nonsense	probably null
R6193:Pcdhb5	UTSW	18	37322027	missense	probably damaging	1.00
R6397:Pcdhb5	UTSW	18	37321505	missense	probably benign	0.08
R6505:Pcdhb5	UTSW	18	37320880	missense	probably benign	0.00
R6737:Pcdhb5	UTSW	18	37322670	missense	probably damaging	1.00
R7146:Pcdhb5	UTSW	18	37321356	missense	probably damaging	1.00
R7162:Pcdhb5	UTSW	18	37321686	missense	probably benign	0.16
R7584:Pcdhb5	UTSW	18	37322372	missense	possibly damaging	0.90
R8214:Pcdhb5	UTSW	18	37321583	missense	probably benign	0.37
R8327:Pcdhb5	UTSW	18	37320900	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCTCAGTCCCAGAAAATTCTC -3'
(R):5'- GTGATGTGAGCATTGGAGCC -3'

Sequencing Primer
(F):5'- AATTCTCCAGAAACTGTGGTCGC -3'
(R):5'- GAGCATTGGAGCCTGAGTC -3'

Posted On

2018-06-25