Incidental Mutation 'R6608:Zp1'
ID526443
Institutional Source Beutler Lab
Gene Symbol Zp1
Ensembl Gene ENSMUSG00000024734
Gene Namezona pellucida glycoprotein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6608 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10914287-10920632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10918980 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 127 (C127Y)
Ref Sequence ENSEMBL: ENSMUSP00000025641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025641] [ENSMUST00000168708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025641
AA Change: C127Y

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025641
Gene: ENSMUSG00000024734
AA Change: C127Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
PD 226 269 2.33e-11 SMART
ZP 271 542 1.55e-102 SMART
low complexity region 580 589 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168708
SMART Domains Protein: ENSMUSP00000128543
Gene: ENSMUSG00000024734

DomainStartEndE-ValueType
Pfam:Zona_pellucida 3 61 5.6e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene ensures the structural integrity of the zona pellucida. Mutations in this gene are a cause of oocyte maturation defect and infertility. [provided by RefSeq, May 2014]
PHENOTYPE: Female homozygous mutants produce oocytes with abnormal zona pellucida. Fecunditiy is significantly reduced, probably due to precocious hatching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,632,492 T571A probably benign Het
Adamts18 A T 8: 113,775,279 Y317N probably damaging Het
Adgrg5 T C 8: 94,941,720 F470S probably damaging Het
AK157302 T C 13: 21,495,624 S107P probably damaging Het
Ankrd31 A G 13: 96,832,780 Y975C probably damaging Het
Ankrd37 C T 8: 45,999,854 probably benign Het
Aox1 T C 1: 58,057,546 Y267H probably benign Het
Cdan1 A C 2: 120,726,680 I555R possibly damaging Het
Clns1a A G 7: 97,716,468 T226A probably benign Het
Col18a1 C T 10: 77,112,794 probably benign Het
Col5a3 C A 9: 20,774,019 V1454L unknown Het
Coq6 G A 12: 84,372,148 V309I probably benign Het
Decr2 C T 17: 26,083,884 V173M probably benign Het
Dmgdh G A 13: 93,706,744 G363S possibly damaging Het
Dnah7a A T 1: 53,525,118 D1927E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Epm2a T C 10: 11,390,987 probably null Het
Gm1979 T A 5: 26,001,096 H162L probably benign Het
Knl1 A G 2: 119,086,612 N1759D probably damaging Het
Man1b1 T A 2: 25,343,251 V212E probably damaging Het
Marf1 A G 16: 14,132,714 L936S probably damaging Het
Mki67 G A 7: 135,698,361 T1648I probably benign Het
Mrvi1 A T 7: 110,888,551 S486T probably damaging Het
Olfr1168 A G 2: 88,185,705 Y276C possibly damaging Het
Olfr135 T C 17: 38,208,479 V78A probably damaging Het
Olfr401 T C 11: 74,121,628 V113A probably benign Het
Olfr430 A G 1: 174,069,729 M144V probably benign Het
Parp11 A G 6: 127,477,848 I110V possibly damaging Het
Pcdhb5 A G 18: 37,321,823 T419A probably damaging Het
Pitpnm1 A G 19: 4,110,875 D838G probably damaging Het
Rbm26 T A 14: 105,152,498 N230I probably damaging Het
Rnf20 C T 4: 49,650,051 S540F probably benign Het
Rsad1 T C 11: 94,542,609 D417G probably damaging Het
Serpina3c A T 12: 104,149,624 N220K probably benign Het
Slc6a19 A G 13: 73,683,972 L495P probably damaging Het
Stard7 A T 2: 127,290,795 K194N probably damaging Het
Tinagl1 A G 4: 130,172,989 M105T probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Usp10 C T 8: 119,948,422 R461W probably benign Het
Wsb1 C T 11: 79,240,362 E403K probably benign Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zzef1 T A 11: 72,912,826 F2466L probably damaging Het
Other mutations in Zp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zp1 APN 19 10918777 missense probably damaging 1.00
IGL01504:Zp1 APN 19 10919011 missense probably damaging 0.99
IGL02260:Zp1 APN 19 10916714 unclassified probably benign
IGL02465:Zp1 APN 19 10920487 missense probably benign 0.09
IGL02634:Zp1 APN 19 10919507 unclassified probably benign
IGL02714:Zp1 APN 19 10918612 missense probably damaging 1.00
IGL03234:Zp1 APN 19 10914823 splice site probably benign
IGL03404:Zp1 APN 19 10914461 unclassified probably benign
R0504:Zp1 UTSW 19 10916207 missense probably damaging 0.98
R0554:Zp1 UTSW 19 10920562 missense probably benign 0.29
R1028:Zp1 UTSW 19 10918911 missense probably benign 0.01
R1279:Zp1 UTSW 19 10918577 missense probably damaging 1.00
R1460:Zp1 UTSW 19 10918878 missense probably benign
R3425:Zp1 UTSW 19 10918592 missense probably benign 0.00
R3832:Zp1 UTSW 19 10916524 missense probably damaging 1.00
R4420:Zp1 UTSW 19 10914760 splice site probably null
R4669:Zp1 UTSW 19 10918905 missense probably benign 0.31
R4849:Zp1 UTSW 19 10918834 missense possibly damaging 0.90
R5134:Zp1 UTSW 19 10920562 missense probably benign 0.29
R5170:Zp1 UTSW 19 10920554 missense possibly damaging 0.56
R5510:Zp1 UTSW 19 10919405 missense probably damaging 1.00
R6284:Zp1 UTSW 19 10916503 missense probably damaging 1.00
R6307:Zp1 UTSW 19 10916720 missense probably null 0.45
R6378:Zp1 UTSW 19 10914853 missense probably benign 0.15
R6697:Zp1 UTSW 19 10914835 missense probably benign 0.05
R6862:Zp1 UTSW 19 10916513 missense possibly damaging 0.84
R7054:Zp1 UTSW 19 10918740 missense probably damaging 0.98
R7253:Zp1 UTSW 19 10916569 missense probably damaging 0.99
R7483:Zp1 UTSW 19 10917916 missense possibly damaging 0.72
R7591:Zp1 UTSW 19 10919471 missense probably damaging 1.00
Z1176:Zp1 UTSW 19 10917914 missense probably damaging 1.00
Z1177:Zp1 UTSW 19 10918604 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTGGATCCAGCAGGTC -3'
(R):5'- CAGGACTGGGTGTAGTCAACAG -3'

Sequencing Primer
(F):5'- ATCCAGCAGGTCCAGGTCCTAG -3'
(R):5'- GTGTAGTCAACAGCCAGGCAC -3'
Posted On2018-06-25