Incidental Mutation 'R6171:Sp110'
ID526447
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 044314-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R6171 (G1)
Quality Score48.0072
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85577329 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 434 (F434C)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
AA Change: F434C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: F434C

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect probably benign
Transcript: ENSMUST00000178024
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 A G 4: 126,317,317 V269A probably damaging Het
Atp11a T A 8: 12,832,663 V517D probably damaging Het
Atr C T 9: 95,881,271 Q1073* probably null Het
C87436 A C 6: 86,445,467 T8P probably benign Het
Clasrp T C 7: 19,584,822 probably benign Het
Creb3l1 G T 2: 91,991,269 Q254K probably damaging Het
Dapl1 C A 2: 59,496,602 T64K probably benign Het
Dnah2 A T 11: 69,423,042 L4168Q probably damaging Het
Dnttip2 T A 3: 122,278,862 I597N probably damaging Het
Dyrk1b A T 7: 28,186,550 probably null Het
Elk3 G T 10: 93,250,044 P132Q probably damaging Het
Galt C T 4: 41,757,541 P238S probably damaging Het
Gm10322 T C 10: 59,616,262 V67A possibly damaging Het
Ice1 T C 13: 70,606,731 Y412C probably benign Het
Kcna1 A T 6: 126,642,323 Y345N probably damaging Het
Kif1b T C 4: 149,258,048 Y419C probably damaging Het
Klf15 G T 6: 90,466,619 A59S possibly damaging Het
Mettl17 T A 14: 51,888,779 Y162N probably damaging Het
Myh10 G A 11: 68,791,890 R1050Q probably damaging Het
Nek4 T C 14: 30,970,347 V376A probably benign Het
Nemp1 T A 10: 127,689,450 probably null Het
Nlrp9a T C 7: 26,558,763 I602T possibly damaging Het
Nphp4 T C 4: 152,544,449 V764A probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr895 C T 9: 38,268,602 Q22* probably null Het
Osbp2 A T 11: 3,717,221 probably null Het
Pax2 A G 19: 44,790,740 Y185C probably damaging Het
Pdyn A T 2: 129,688,348 S134T possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppp1r13l A G 7: 19,377,511 M754V probably benign Het
Prr23a3 T A 9: 98,865,678 N228K probably benign Het
Psmd12 T C 11: 107,491,907 F213L probably damaging Het
Qser1 A T 2: 104,789,283 S395T probably damaging Het
Rab7b A G 1: 131,698,634 probably null Het
Rev3l T A 10: 39,862,713 L2821* probably null Het
Rplp0 A G 5: 115,561,160 N127S probably benign Het
Serpina9 G T 12: 104,008,419 Y158* probably null Het
Sis G A 3: 72,961,027 T110M possibly damaging Het
Slc43a2 A G 11: 75,563,050 Y263C probably damaging Het
Stard13 A T 5: 151,092,762 V88E probably damaging Het
Trim29 G A 9: 43,319,377 E286K probably damaging Het
Vmn2r24 T C 6: 123,787,246 S361P probably damaging Het
Wnk2 T C 13: 49,060,832 T18A probably damaging Het
Xylb C T 9: 119,381,591 T380M probably damaging Het
Zbtb5 T C 4: 44,994,119 T422A probably benign Het
Zhx2 A G 15: 57,823,206 E657G probably damaging Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTCAGAGGCTCAAAGGC -3'
(R):5'- AAAGGGGAGAGTTACCTTATCAC -3'

Sequencing Primer
(F):5'- CTCAGAGGCTCAAAGGCAAAGTTC -3'
(R):5'- TTATCACTAAGGGGAAACTTAAAAGG -3'
Posted On2018-06-28