Incidental Mutation 'R6234:Mroh2a'
ID 526449
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Name maestro heat-like repeat family member 2A
Synonyms ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804
MMRRC Submission 044399-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R6234 (G1)
Quality Score 78.0075
Status Validated
Chromosome 1
Chromosomal Location 88154713-88190011 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 88162334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
AlphaFold D3Z750
Predicted Effect probably null
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148474
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l T G 8: 44,078,949 (GRCm39) N425T probably benign Het
Adgb A C 10: 10,228,824 (GRCm39) probably null Het
Aldoart1 A G 4: 72,770,409 (GRCm39) I78T probably damaging Het
Bcl2l2 A G 14: 55,122,245 (GRCm39) D136G probably benign Het
Bltp1 A G 3: 37,037,620 (GRCm39) T2475A probably benign Het
Cd34 A T 1: 194,630,308 (GRCm39) I81F probably damaging Het
Chmp1b T A 18: 67,339,169 (GRCm39) *200R probably null Het
Clic6 T C 16: 92,296,110 (GRCm39) S257P probably benign Het
Cnga4 T G 7: 105,056,906 (GRCm39) Y336* probably null Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Eef1akmt2 T C 7: 132,429,585 (GRCm39) T215A probably damaging Het
Fbrsl1 G A 5: 110,525,917 (GRCm39) T95I probably damaging Het
Fer1l6 T C 15: 58,432,488 (GRCm39) I345T probably damaging Het
Fmn1 T C 2: 113,196,000 (GRCm39) F567L unknown Het
Ftdc1 T A 16: 58,435,034 (GRCm39) D97V probably benign Het
Gabrg1 A T 5: 70,999,484 (GRCm39) L22I probably benign Het
Gfm1 A G 3: 67,342,847 (GRCm39) D127G probably damaging Het
Gm5114 T A 7: 39,058,768 (GRCm39) T284S probably benign Het
Gm9925 A T 18: 74,198,308 (GRCm39) probably benign Het
Hc T C 2: 34,918,058 (GRCm39) I742V probably benign Het
Heatr5a A T 12: 51,924,237 (GRCm39) M1992K possibly damaging Het
Homer3 T C 8: 70,743,815 (GRCm39) probably null Het
Hsf5 C G 11: 87,508,120 (GRCm39) T8S probably benign Het
Hspa4 C T 11: 53,153,766 (GRCm39) E702K probably benign Het
Il21r A G 7: 125,231,757 (GRCm39) D395G probably damaging Het
Kctd14 T A 7: 97,107,219 (GRCm39) V190E probably damaging Het
Mamdc4 C G 2: 25,460,092 (GRCm39) G57A probably damaging Het
Mtch1 A T 17: 29,559,485 (GRCm39) probably null Het
Nasp G A 4: 116,479,979 (GRCm39) A31V possibly damaging Het
Neil3 G T 8: 54,061,774 (GRCm39) D202E probably damaging Het
Nfkb1 C T 3: 135,332,471 (GRCm39) V95I possibly damaging Het
Ptpra T A 2: 130,379,508 (GRCm39) M327K probably damaging Het
Ptprg C A 14: 12,213,747 (GRCm38) F263L probably damaging Het
Sap30 A G 8: 57,938,152 (GRCm39) V155A probably damaging Het
Serpinb2 G A 1: 107,452,501 (GRCm39) V360M probably damaging Het
Stradb A G 1: 59,027,707 (GRCm39) H79R probably damaging Het
Svep1 A T 4: 58,113,458 (GRCm39) probably null Het
Tcaf2 A T 6: 42,607,308 (GRCm39) H215Q probably benign Het
Tdrd5 A T 1: 156,120,947 (GRCm39) S227T possibly damaging Het
Timmdc1 A T 16: 38,338,861 (GRCm39) Y76* probably null Het
Tmbim4 T A 10: 120,057,628 (GRCm39) probably null Het
Tpr A G 1: 150,293,790 (GRCm39) K854R probably benign Het
Trav6-5 A G 14: 53,728,832 (GRCm39) T30A probably benign Het
Trrap T A 5: 144,776,523 (GRCm39) probably null Het
Ube2o A T 11: 116,430,316 (GRCm39) S1141T probably benign Het
Usp54 T A 14: 20,633,518 (GRCm39) K339I probably damaging Het
Vwf T G 6: 125,634,128 (GRCm39) V202G unknown Het
Wdr7 T C 18: 63,857,203 (GRCm39) L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,994,494 (GRCm39) probably null Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88,172,692 (GRCm39) missense probably benign 0.03
IGL00990:Mroh2a APN 1 88,161,842 (GRCm39) missense possibly damaging 0.76
IGL00990:Mroh2a APN 1 88,158,468 (GRCm39) missense probably damaging 0.99
IGL03097:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R0032:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0068:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0139:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0374:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R0536:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0548:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0583:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0613:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0657:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88,156,102 (GRCm39) missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0689:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0735:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0845:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0853:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0959:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R0960:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1028:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1268:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1281:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
R1414:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1439:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88,169,353 (GRCm39) missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88,160,075 (GRCm39) splice site probably benign
R1442:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R1686:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1686:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1780:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1846:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1899:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1958:Mroh2a UTSW 1 88,165,213 (GRCm39) nonsense probably null
R2122:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2248:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2306:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R2869:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2870:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2871:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3408:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3608:Mroh2a UTSW 1 88,172,717 (GRCm39) missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3937:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4022:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4133:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88,187,311 (GRCm39) missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4625:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4665:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4701:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R4701:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4771:Mroh2a UTSW 1 88,179,087 (GRCm39) missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4839:Mroh2a UTSW 1 88,165,666 (GRCm39) missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R5007:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5031:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5062:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5301:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5367:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5446:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5506:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5561:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5615:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5825:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R5891:Mroh2a UTSW 1 88,169,337 (GRCm39) missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5928:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R6004:Mroh2a UTSW 1 88,176,377 (GRCm39) missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88,158,390 (GRCm39) missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6074:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R6091:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6127:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6234:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6244:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6464:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6575:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6809:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R6819:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7818:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R8350:Mroh2a UTSW 1 88,171,805 (GRCm39) splice site probably null
R9414:Mroh2a UTSW 1 88,179,096 (GRCm39) missense probably benign 0.26
RF024:Mroh2a UTSW 1 88,170,207 (GRCm39) missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88,154,813 (GRCm39) start gained probably benign
V8831:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
X0027:Mroh2a UTSW 1 88,176,335 (GRCm39) missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0028:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0033:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,160,014 (GRCm39) missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0039:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,377 (GRCm39) missense probably benign 0.25
X0057:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0063:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1188:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Z1190:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1192:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGTAACTAAGAACCATGGGG -3'
(R):5'- ACCTTCCCTGGATGACTTGTG -3'

Sequencing Primer
(F):5'- GGACCCTTGAGCAGTTATACC -3'
(R):5'- GATGACTTGTGTGCCTGATAAAC -3'
Posted On 2018-06-28