Incidental Mutation 'R6234:Hsf5'
ID526454
Institutional Source Beutler Lab
Gene Symbol Hsf5
Ensembl Gene ENSMUSG00000070345
Gene Nameheat shock transcription factor family member 5
SynonymsLOC327992
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R6234 (G1)
Quality Score77.0075
Status Validated
Chromosome11
Chromosomal Location87617164-87659542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 87617294 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 8 (T8S)
Ref Sequence ENSEMBL: ENSMUSP00000091488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000093956] [ENSMUST00000103179] [ENSMUST00000119628]
Predicted Effect probably benign
Transcript: ENSMUST00000092802
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093956
AA Change: T8S

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091488
Gene: ENSMUSG00000070345
AA Change: T8S

DomainStartEndE-ValueType
HSF 11 153 2.35e-9 SMART
Blast:HSF 163 423 1e-149 BLAST
low complexity region 442 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103179
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119628
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,983,471 T2475A probably benign Het
Adgb A C 10: 10,353,080 probably null Het
Aldoart1 A G 4: 72,852,172 I78T probably damaging Het
Bcl2l2 A G 14: 54,884,788 D136G probably benign Het
Cd34 A T 1: 194,948,000 I81F probably damaging Het
Chmp1b T A 18: 67,206,098 *200R probably null Het
Clic6 T C 16: 92,499,222 S257P probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Eef1akmt2 T C 7: 132,827,856 T215A probably damaging Het
Fbrsl1 G A 5: 110,378,051 T95I probably damaging Het
Fer1l6 T C 15: 58,560,639 I345T probably damaging Het
Fmn1 T C 2: 113,365,655 F567L unknown Het
Gabrg1 A T 5: 70,842,141 L22I probably benign Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm5114 T A 7: 39,409,344 T284S probably benign Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Gm813 T A 16: 58,614,671 D97V probably benign Het
Gm9925 A T 18: 74,065,237 probably benign Het
Hc T C 2: 35,028,046 I742V probably benign Het
Heatr5a A T 12: 51,877,454 M1992K possibly damaging Het
Homer3 T C 8: 70,291,165 probably null Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Il21r A G 7: 125,632,585 D395G probably damaging Het
Kctd14 T A 7: 97,458,012 V190E probably damaging Het
Mamdc4 C G 2: 25,570,080 G57A probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Mtch1 A T 17: 29,340,511 probably null Het
Nasp G A 4: 116,622,782 A31V possibly damaging Het
Neil3 G T 8: 53,608,739 D202E probably damaging Het
Nfkb1 C T 3: 135,626,710 V95I possibly damaging Het
Ptpra T A 2: 130,537,588 M327K probably damaging Het
Ptprg C A 14: 12,213,747 F263L probably damaging Het
Sap30 A G 8: 57,485,118 V155A probably damaging Het
Serpinb2 G A 1: 107,524,771 V360M probably damaging Het
Stradb A G 1: 58,988,548 H79R probably damaging Het
Svep1 A T 4: 58,113,458 probably null Het
Tcaf2 A T 6: 42,630,374 H215Q probably benign Het
Tdrd5 A T 1: 156,293,377 S227T possibly damaging Het
Timmdc1 A T 16: 38,518,499 Y76* probably null Het
Tmbim4 T A 10: 120,221,723 probably null Het
Tpr A G 1: 150,418,039 K854R probably benign Het
Trav6-5 A G 14: 53,491,375 T30A probably benign Het
Trrap T A 5: 144,839,713 probably null Het
Ube2o A T 11: 116,539,490 S1141T probably benign Het
Usp54 T A 14: 20,583,450 K339I probably damaging Het
Vwf T G 6: 125,657,165 V202G unknown Het
Wdr7 T C 18: 63,724,132 L93P probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Other mutations in Hsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Hsf5 APN 11 87623096 missense probably damaging 0.99
IGL01726:Hsf5 APN 11 87636125 missense probably benign 0.22
IGL02480:Hsf5 APN 11 87631657 missense possibly damaging 0.67
IGL02572:Hsf5 APN 11 87631695 splice site probably benign
IGL03113:Hsf5 APN 11 87657364 missense probably benign 0.03
R0015:Hsf5 UTSW 11 87657335 missense probably benign
R0015:Hsf5 UTSW 11 87657335 missense probably benign
R1381:Hsf5 UTSW 11 87638169 missense probably benign
R1807:Hsf5 UTSW 11 87657342 missense probably benign 0.04
R1838:Hsf5 UTSW 11 87636055 missense probably benign 0.45
R2187:Hsf5 UTSW 11 87638184 missense possibly damaging 0.51
R3930:Hsf5 UTSW 11 87631682 missense probably damaging 1.00
R3931:Hsf5 UTSW 11 87631682 missense probably damaging 1.00
R4420:Hsf5 UTSW 11 87657304 missense probably benign 0.02
R4423:Hsf5 UTSW 11 87631634 missense probably damaging 0.99
R4744:Hsf5 UTSW 11 87622791 missense probably benign 0.02
R4795:Hsf5 UTSW 11 87635620 missense probably benign 0.18
R5862:Hsf5 UTSW 11 87622991 missense probably damaging 0.96
R6232:Hsf5 UTSW 11 87617294 missense probably benign 0.05
R6609:Hsf5 UTSW 11 87635953 missense probably damaging 0.99
R7821:Hsf5 UTSW 11 87638128 missense probably benign 0.04
R7989:Hsf5 UTSW 11 87635624 missense probably benign 0.07
Z1177:Hsf5 UTSW 11 87638133 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGTAGCCTTGTGTCGCAG -3'
(R):5'- AAGCCGTAGAGGTTGAGCTG -3'

Sequencing Primer
(F):5'- AGCCTTGTGTCGCAGTGTCC -3'
(R):5'- TTGAGCTGGCGGATGAAGC -3'
Posted On2018-06-28