Incidental Mutation 'R6173:Mfap4'
ID526476
Institutional Source Beutler Lab
Gene Symbol Mfap4
Ensembl Gene ENSMUSG00000042436
Gene Namemicrofibrillar-associated protein 4
Synonyms1110007F23Rik
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6173 (G1)
Quality Score66.0074
Status Validated
Chromosome11
Chromosomal Location61485431-61488900 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 61485419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040522] [ENSMUST00000064783] [ENSMUST00000079080] [ENSMUST00000101085] [ENSMUST00000108714] [ENSMUST00000153441]
Predicted Effect probably benign
Transcript: ENSMUST00000040522
SMART Domains Protein: ENSMUSP00000038971
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 280 5.6e-119 SMART
Predicted Effect probably null
Transcript: ENSMUST00000064783
SMART Domains Protein: ENSMUSP00000070848
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 257 3.39e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079080
SMART Domains Protein: ENSMUSP00000078087
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 55 347 5.66e-96 SMART
low complexity region 433 447 N/A INTRINSIC
low complexity region 476 492 N/A INTRINSIC
coiled coil region 508 544 N/A INTRINSIC
low complexity region 578 603 N/A INTRINSIC
low complexity region 620 644 N/A INTRINSIC
low complexity region 675 692 N/A INTRINSIC
low complexity region 758 772 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101085
SMART Domains Protein: ENSMUSP00000098646
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 4 277 3.48e-73 SMART
low complexity region 363 377 N/A INTRINSIC
coiled coil region 405 441 N/A INTRINSIC
low complexity region 475 500 N/A INTRINSIC
low complexity region 517 541 N/A INTRINSIC
low complexity region 572 589 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 688 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108714
SMART Domains Protein: ENSMUSP00000104354
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 1 278 1.76e-74 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 407 423 N/A INTRINSIC
coiled coil region 439 475 N/A INTRINSIC
low complexity region 509 534 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
low complexity region 606 623 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152755
Predicted Effect probably benign
Transcript: ENSMUST00000153441
SMART Domains Protein: ENSMUSP00000116084
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
PDB:4IC8|B 1 49 2e-26 PDB
low complexity region 51 65 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
coiled coil region 126 162 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to a bovine microfibril-associated protein. The protein has binding specificities for both collagen and carbohydrate. It is thought to be an extracellular matrix protein which is involved in cell adhesion or intercellular interactions. The gene is located within the Smith-Magenis syndrome region. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneous air space enlargement in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Mfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Mfap4 APN 11 61487781 missense possibly damaging 0.94
IGL01482:Mfap4 APN 11 61487757 missense probably damaging 1.00
R0512:Mfap4 UTSW 11 61487945 missense probably damaging 1.00
R0631:Mfap4 UTSW 11 61487180 missense probably damaging 0.99
R1991:Mfap4 UTSW 11 61485807 critical splice donor site probably null
R2680:Mfap4 UTSW 11 61487231 missense probably benign 0.03
R4614:Mfap4 UTSW 11 61485509 unclassified probably benign
R4616:Mfap4 UTSW 11 61485509 unclassified probably benign
R4617:Mfap4 UTSW 11 61485509 unclassified probably benign
R4675:Mfap4 UTSW 11 61485510 unclassified probably benign
R4987:Mfap4 UTSW 11 61486082 missense probably benign 0.14
R5381:Mfap4 UTSW 11 61487930 missense probably benign 0.06
R7640:Mfap4 UTSW 11 61487087 missense probably damaging 1.00
R7695:Mfap4 UTSW 11 61485719 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTTGCCAAAGGACCCACAAG -3'
(R):5'- CTTTCAGAGGAAGGCCCAATATC -3'

Sequencing Primer
(F):5'- TCCAGGGTACAGTTGCGG -3'
(R):5'- TCCCCAGAACTTAAGTTTCAAGAG -3'
Posted On2018-07-16