Incidental Mutation 'R6173:Zfp36l1'
ID526477
Institutional Source Beutler Lab
Gene Symbol Zfp36l1
Ensembl Gene ENSMUSG00000021127
Gene Namezinc finger protein 36, C3H type-like 1
SynonymsTIS11b, D530020L18Rik, Brf1, cMG1
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6173 (G1)
Quality Score75.0075
Status Validated
Chromosome12
Chromosomal Location80107754-80113013 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 80109546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021552] [ENSMUST00000165114] [ENSMUST00000218835] [ENSMUST00000219642]
Predicted Effect probably benign
Transcript: ENSMUST00000021552
SMART Domains Protein: ENSMUSP00000021552
Gene: ENSMUSG00000021127

DomainStartEndE-ValueType
Pfam:Tis11B_N 1 107 3.2e-50 PFAM
ZnF_C3H1 114 141 1.07e-9 SMART
ZnF_C3H1 152 179 2.1e-8 SMART
low complexity region 201 218 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 290 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165114
SMART Domains Protein: ENSMUSP00000127522
Gene: ENSMUSG00000021127

DomainStartEndE-ValueType
Pfam:Tis11B_N 1 105 2.7e-33 PFAM
ZnF_C3H1 114 141 1.07e-9 SMART
ZnF_C3H1 152 179 2.1e-8 SMART
low complexity region 201 218 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 290 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181323
Predicted Effect probably null
Transcript: ENSMUST00000218835
Predicted Effect probably benign
Transcript: ENSMUST00000219642
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TIS11 family of early response genes, which are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. This gene is well conserved across species and has a promoter that contains motifs seen in other early-response genes. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality with failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Zfp36l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp36l1 APN 12 80110464 missense probably damaging 0.97
brontosouris UTSW 12 80112822 nonsense probably null
R4714:Zfp36l1 UTSW 12 80110496 missense possibly damaging 0.92
R4898:Zfp36l1 UTSW 12 80110524 missense probably benign 0.37
R5908:Zfp36l1 UTSW 12 80109675 missense possibly damaging 0.85
R6235:Zfp36l1 UTSW 12 80112822 nonsense probably null
RF014:Zfp36l1 UTSW 12 80109744 missense probably benign 0.08
Z1177:Zfp36l1 UTSW 12 80109657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGGAACTCTGTTATGCGTG -3'
(R):5'- ATGTCCGAATCCCCTCACATG -3'

Sequencing Primer
(F):5'- GAACTCTGTTATGCGTGGTTAAG -3'
(R):5'- CGAATCCCCTCACATGTTTGAC -3'
Posted On2018-07-16