Incidental Mutation 'R6173:2410141K09Rik'
ID526478
Institutional Source Beutler Lab
Gene Symbol 2410141K09Rik
Ensembl Gene ENSMUSG00000074832
Gene NameRIKEN cDNA 2410141K09 gene
SynonymsGt(Ayu21)35Imeg, Gt(pU21)35Imeg
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6173 (G1)
Quality Score62.0073
Status Validated
Chromosome13
Chromosomal Location66418114-66441118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66431549 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 292 (T292S)
Ref Sequence ENSEMBL: ENSMUSP00000134352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091541] [ENSMUST00000172579] [ENSMUST00000173583]
Predicted Effect probably benign
Transcript: ENSMUST00000091541
SMART Domains Protein: ENSMUSP00000089126
Gene: ENSMUSG00000074832

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172579
AA Change: T292S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134352
Gene: ENSMUSG00000074832
AA Change: T292S

DomainStartEndE-ValueType
KRAB 4 66 3.3e-15 SMART
ZnF_C2H2 75 97 1.72e-4 SMART
ZnF_C2H2 103 125 1.06e-4 SMART
ZnF_C2H2 131 153 5.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173583
SMART Domains Protein: ENSMUSP00000134048
Gene: ENSMUSG00000074832

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225647
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in 2410141K09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2698:2410141K09Rik UTSW 13 66433434 missense probably damaging 0.99
R2881:2410141K09Rik UTSW 13 66431270 missense probably damaging 1.00
R5217:2410141K09Rik UTSW 13 66433726 missense probably damaging 1.00
R5401:2410141K09Rik UTSW 13 66431663 missense probably benign 0.01
R5429:2410141K09Rik UTSW 13 66431828 missense probably benign 0.00
R5532:2410141K09Rik UTSW 13 66431681 missense probably damaging 1.00
R5626:2410141K09Rik UTSW 13 66431981 missense probably benign 0.00
R5686:2410141K09Rik UTSW 13 66431663 missense probably benign 0.01
R6151:2410141K09Rik UTSW 13 66431681 missense probably damaging 1.00
R6857:2410141K09Rik UTSW 13 66432102 missense probably benign
R7405:2410141K09Rik UTSW 13 66431059 missense unknown
R7737:2410141K09Rik UTSW 13 66433677 critical splice donor site probably null
Z1088:2410141K09Rik UTSW 13 66431186 missense probably damaging 1.00
Z1088:2410141K09Rik UTSW 13 66431741 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAGCGGGTCTTGCAAAGG -3'
(R):5'- AGACCCGCTGATCTCCAA -3'

Sequencing Primer
(F):5'- CGGGTCTTGCAAAGGCTTTACTAC -3'
(R):5'- ATCAATGTGGGAAAGCCTTTGC -3'
Posted On2018-07-16