Incidental Mutation 'R6653:Asb15'
ID526504
Institutional Source Beutler Lab
Gene Symbol Asb15
Ensembl Gene ENSMUSG00000029685
Gene Nameankyrin repeat and SOCS box-containing 15
Synonyms4930400E23Rik
MMRRC Submission
Accession Numbers

Genbank: NM_080847; MGI: 1926160

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location24528144-24573164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24562633 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 198 (N198S)
Ref Sequence ENSEMBL: ENSMUSP00000112965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031696] [ENSMUST00000117688]
Predicted Effect probably benign
Transcript: ENSMUST00000031696
AA Change: N198S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031696
Gene: ENSMUSG00000029685
AA Change: N198S

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117688
AA Change: N198S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112965
Gene: ENSMUSG00000029685
AA Change: N198S

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling box superfamily. The proteins in this superfamily participate in the ubiquitin-proteasome system for the degradation of proteins in the cell cycle and signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Asb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Asb15 APN 6 24558643 splice site probably benign
IGL00557:Asb15 APN 6 24558650 missense probably benign
IGL00694:Asb15 APN 6 24570664 missense possibly damaging 0.79
IGL01137:Asb15 APN 6 24556522 missense probably benign
IGL01681:Asb15 APN 6 24567138 missense probably damaging 0.98
IGL01691:Asb15 APN 6 24567272 missense probably benign 0.02
IGL01791:Asb15 APN 6 24567212 missense probably damaging 1.00
IGL01989:Asb15 APN 6 24565944 missense probably damaging 1.00
IGL02480:Asb15 APN 6 24570746 missense probably damaging 0.99
IGL02541:Asb15 APN 6 24566266 missense probably damaging 1.00
IGL02707:Asb15 APN 6 24558788 splice site probably benign
IGL03090:Asb15 APN 6 24567186 missense possibly damaging 0.52
IGL03331:Asb15 APN 6 24556524 missense possibly damaging 0.70
3-1:Asb15 UTSW 6 24566221 missense probably benign 0.00
BB002:Asb15 UTSW 6 24562724 missense probably benign 0.00
BB012:Asb15 UTSW 6 24562724 missense probably benign 0.00
R0196:Asb15 UTSW 6 24564393 missense probably damaging 0.99
R0603:Asb15 UTSW 6 24556557 missense probably damaging 1.00
R0650:Asb15 UTSW 6 24566164 missense probably damaging 1.00
R1114:Asb15 UTSW 6 24567177 missense probably damaging 1.00
R1170:Asb15 UTSW 6 24562487 splice site probably benign
R1365:Asb15 UTSW 6 24567270 missense possibly damaging 0.95
R2323:Asb15 UTSW 6 24556601 missense probably benign 0.01
R3147:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R3148:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R4762:Asb15 UTSW 6 24567237 missense possibly damaging 0.81
R4771:Asb15 UTSW 6 24570622 missense probably damaging 0.99
R4915:Asb15 UTSW 6 24566293 missense probably damaging 0.96
R5369:Asb15 UTSW 6 24562564 missense probably benign 0.00
R5415:Asb15 UTSW 6 24570691 missense probably benign 0.05
R5781:Asb15 UTSW 6 24564378 missense probably benign 0.11
R6649:Asb15 UTSW 6 24562633 missense probably benign
R6781:Asb15 UTSW 6 24558675 missense probably benign
R6984:Asb15 UTSW 6 24566337 missense probably benign 0.17
R7297:Asb15 UTSW 6 24566463 missense probably damaging 0.96
R7340:Asb15 UTSW 6 24558514 missense probably benign 0.00
R7419:Asb15 UTSW 6 24556556 missense probably benign 0.08
R7549:Asb15 UTSW 6 24559030 splice site probably null
R7662:Asb15 UTSW 6 24566090 missense probably benign 0.08
R7717:Asb15 UTSW 6 24559252 missense probably benign
R7767:Asb15 UTSW 6 24559282 missense probably benign
R7781:Asb15 UTSW 6 24562645 missense probably benign 0.01
R7797:Asb15 UTSW 6 24562506 missense probably damaging 0.98
R7847:Asb15 UTSW 6 24564267 missense probably damaging 1.00
R7925:Asb15 UTSW 6 24562724 missense probably benign 0.00
R8055:Asb15 UTSW 6 24556566 missense probably benign 0.05
R8304:Asb15 UTSW 6 24559297 missense possibly damaging 0.89
R8694:Asb15 UTSW 6 24570667 missense probably benign 0.00
Z1176:Asb15 UTSW 6 24566331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAAGGCCTCATGTTGATAAGGC -3'
(R):5'- GGGCTAGGATAAAACCCCAC -3'

Sequencing Primer
(F):5'- GGCAACTTCATGTTAATCTTCCTG -3'
(R):5'- CACCCATTTATACTCAGGAGGGAG -3'
Posted On2018-07-23