Incidental Mutation 'R6653:Glb1l3'
ID526513
Institutional Source Beutler Lab
Gene Symbol Glb1l3
Ensembl Gene ENSMUSG00000031966
Gene Namegalactosidase, beta 1 like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location26817953-26860890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26859588 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 61 (T61A)
Ref Sequence ENSEMBL: ENSMUSP00000147979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034448] [ENSMUST00000210274]
Predicted Effect probably benign
Transcript: ENSMUST00000034448
SMART Domains Protein: ENSMUSP00000034448
Gene: ENSMUSG00000031966

DomainStartEndE-ValueType
Pfam:Glyco_hydro_35 1 304 1.5e-110 PFAM
Pfam:Glyco_hydro_42 7 160 6.2e-11 PFAM
low complexity region 309 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210274
AA Change: T61A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Glb1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Glb1l3 APN 9 26853671 missense probably damaging 1.00
IGL00537:Glb1l3 APN 9 26829050 missense probably damaging 1.00
IGL01139:Glb1l3 APN 9 26818227 missense probably benign 0.00
IGL01397:Glb1l3 APN 9 26825195 missense probably benign
IGL01603:Glb1l3 APN 9 26859536 missense probably damaging 1.00
IGL01938:Glb1l3 APN 9 26818529 missense probably damaging 0.98
IGL02051:Glb1l3 APN 9 26825168 missense probably benign 0.39
IGL02105:Glb1l3 APN 9 26818527 missense probably damaging 0.99
IGL02132:Glb1l3 APN 9 26825170 missense probably benign 0.07
IGL02249:Glb1l3 APN 9 26831268 missense possibly damaging 0.60
IGL02363:Glb1l3 APN 9 26853644 missense probably damaging 1.00
IGL02824:Glb1l3 APN 9 26850109 missense probably damaging 1.00
IGL02938:Glb1l3 APN 9 26826759 missense probably benign 0.26
IGL03181:Glb1l3 APN 9 26828363 splice site probably null
IGL03288:Glb1l3 APN 9 26818305 missense probably damaging 0.99
IGL03299:Glb1l3 APN 9 26859452 missense probably damaging 1.00
R0479:Glb1l3 UTSW 9 26829093 missense probably benign 0.31
R4036:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4037:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4038:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4039:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4797:Glb1l3 UTSW 9 26828446 missense probably damaging 0.96
R4840:Glb1l3 UTSW 9 26829053 missense probably benign 0.06
R5645:Glb1l3 UTSW 9 26824826 missense probably benign
R5907:Glb1l3 UTSW 9 26826383 missense probably damaging 1.00
R5916:Glb1l3 UTSW 9 26854736 missense probably benign 0.20
R6428:Glb1l3 UTSW 9 26859452 missense probably damaging 1.00
R6489:Glb1l3 UTSW 9 26826831 missense probably benign 0.31
R6532:Glb1l3 UTSW 9 26818442 missense probably benign 0.02
R6560:Glb1l3 UTSW 9 26828424 synonymous probably null
R6802:Glb1l3 UTSW 9 26859352 intron probably null
R7347:Glb1l3 UTSW 9 26829003 missense probably benign
R7531:Glb1l3 UTSW 9 26853654 missense possibly damaging 0.62
R7542:Glb1l3 UTSW 9 26818195 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGTCTGCAGCTGTCTGTGAG -3'
(R):5'- GGGAAGCTTCGTCCCTTTTC -3'

Sequencing Primer
(F):5'- CAGCTGTCTGTGAGGACATATGTC -3'
(R):5'- TTCCTGGGGAAAATAAGGGGCATAC -3'
Posted On2018-07-23