Incidental Mutation 'R6653:Olfr44'
ID526514
Institutional Source Beutler Lab
Gene Symbol Olfr44
Ensembl Gene ENSMUSG00000062649
Gene Nameolfactory receptor 44
SynonymsGA_x6K02T2PVTD-33181773-33180838, MOR171-5, IB3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39481786-39493995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39484752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000150827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077757] [ENSMUST00000215065] [ENSMUST00000216316]
Predicted Effect probably benign
Transcript: ENSMUST00000077757
AA Change: V167A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000076935
Gene: ENSMUSG00000062649
AA Change: V167A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.1e-50 PFAM
Pfam:7tm_1 44 293 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215065
AA Change: V164A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216316
AA Change: V164A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Olfr44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr44 APN 9 39484648 missense probably benign 0.02
IGL02239:Olfr44 APN 9 39484561 missense probably damaging 1.00
IGL02305:Olfr44 APN 9 39485037 missense probably damaging 0.97
IGL02353:Olfr44 APN 9 39485148 missense probably benign
IGL02360:Olfr44 APN 9 39485148 missense probably benign
R0212:Olfr44 UTSW 9 39485088 missense probably damaging 1.00
R0600:Olfr44 UTSW 9 39484988 missense probably benign 0.34
R1329:Olfr44 UTSW 9 39484444 missense probably damaging 0.97
R1348:Olfr44 UTSW 9 39485236 missense probably benign
R1594:Olfr44 UTSW 9 39484746 missense probably benign 0.03
R5017:Olfr44 UTSW 9 39484755 missense possibly damaging 0.90
R5141:Olfr44 UTSW 9 39484531 missense probably damaging 1.00
R5244:Olfr44 UTSW 9 39484512 missense probably damaging 1.00
R5524:Olfr44 UTSW 9 39484987 missense probably damaging 0.97
R5630:Olfr44 UTSW 9 39484951 missense probably benign 0.00
R5860:Olfr44 UTSW 9 39484471 missense probably benign 0.07
R6444:Olfr44 UTSW 9 39484318 missense probably benign 0.04
R6649:Olfr44 UTSW 9 39484752 missense probably benign 0.02
R7115:Olfr44 UTSW 9 39484648 missense probably benign 0.02
R7595:Olfr44 UTSW 9 39484315 missense probably benign 0.05
R7791:Olfr44 UTSW 9 39484881 missense probably damaging 1.00
R8054:Olfr44 UTSW 9 39484737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTAGACCTGCCTTCAG -3'
(R):5'- TCCTCATATTTGCAATTGCGG -3'

Sequencing Primer
(F):5'- TTAGACCTGCCTTCAGTGGAGC -3'
(R):5'- CATATTTGCAATTGCGGAGTGTTAC -3'
Posted On2018-07-23