Incidental Mutation 'R6653:Dlg4'
ID526520
Institutional Source Beutler Lab
Gene Symbol Dlg4
Ensembl Gene ENSMUSG00000020886
Gene Namediscs large MAGUK scaffold protein 4
SynonymsPSD95, Dlgh4, SAP90, PSD-95, SAP90A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6653 (G1)
Quality Score129.008
Status Not validated
Chromosome11
Chromosomal Location70016942-70047522 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 70023953 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000018700] [ENSMUST00000108588] [ENSMUST00000108589] [ENSMUST00000123687] [ENSMUST00000124568] [ENSMUST00000133140] [ENSMUST00000134376] [ENSMUST00000135916] [ENSMUST00000231221] [ENSMUST00000231415] [ENSMUST00000231452] [ENSMUST00000231506] [ENSMUST00000232002]
Predicted Effect probably benign
Transcript: ENSMUST00000018700
SMART Domains Protein: ENSMUSP00000018700
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 64 1.36e-4 SMART
PDZ 73 152 3.38e-21 SMART
PDZ 168 247 1.12e-21 SMART
PDZ 321 394 4.13e-25 SMART
SH3 431 497 1.68e-9 SMART
GuKc 533 712 3.65e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108586
Predicted Effect probably benign
Transcript: ENSMUST00000108588
SMART Domains Protein: ENSMUSP00000104229
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 61 1e-7 SMART
PDZ 70 149 3.38e-21 SMART
PDZ 165 244 1.12e-21 SMART
PDZ 318 391 4.13e-25 SMART
SH3 428 494 1.68e-9 SMART
GuKc 530 709 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108589
SMART Domains Protein: ENSMUSP00000104230
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
MAGUK_N_PEST 53 107 1.36e-4 SMART
PDZ 116 195 3.38e-21 SMART
PDZ 211 290 1.12e-21 SMART
PDZ 364 437 4.13e-25 SMART
SH3 474 540 1.68e-9 SMART
GuKc 576 755 3.65e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123687
SMART Domains Protein: ENSMUSP00000134545
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
SH3 11 77 1.68e-9 SMART
GuKc 113 205 7.37e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124568
SMART Domains Protein: ENSMUSP00000121053
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
low complexity region 9 36 N/A INTRINSIC
MAGUK_N_PEST 69 123 7.67e-4 SMART
Pfam:PDZ 124 185 7.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133140
SMART Domains Protein: ENSMUSP00000126707
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
PDZ 13 92 3.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134376
SMART Domains Protein: ENSMUSP00000115206
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
MAGUK_N_PEST 10 97 3.39e-37 SMART
PDZ 106 165 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135916
SMART Domains Protein: ENSMUSP00000135994
Gene: ENSMUSG00000020886

DomainStartEndE-ValueType
Pfam:PDZ 5 51 6.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231221
Predicted Effect probably benign
Transcript: ENSMUST00000231415
Predicted Effect probably benign
Transcript: ENSMUST00000231452
Predicted Effect probably benign
Transcript: ENSMUST00000231506
Predicted Effect probably benign
Transcript: ENSMUST00000232002
Predicted Effect probably benign
Transcript: ENSMUST00000232659
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. It heteromultimerizes with another MAGUK protein, DLG2, and is recruited into NMDA receptor and potassium channel clusters. These two MAGUK proteins may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severely impaired spatial learning, alterations in long-term potentiation and depression, and lack of hyperalgesia responses in a neuropathic pain model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Dlg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Dlg4 APN 11 70041347 missense probably damaging 1.00
IGL02260:Dlg4 APN 11 70042267 missense probably damaging 1.00
IGL03097:Dlg4 UTSW 11 70042202 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0103:Dlg4 UTSW 11 70031193 missense probably damaging 1.00
R0628:Dlg4 UTSW 11 70031784 missense probably damaging 1.00
R0734:Dlg4 UTSW 11 70042705 missense probably damaging 1.00
R1587:Dlg4 UTSW 11 70031746 missense possibly damaging 0.88
R1946:Dlg4 UTSW 11 70039575 missense probably damaging 1.00
R2190:Dlg4 UTSW 11 70042604 missense probably damaging 1.00
R2259:Dlg4 UTSW 11 70031370 missense probably damaging 1.00
R2289:Dlg4 UTSW 11 70026926 missense probably damaging 1.00
R2411:Dlg4 UTSW 11 70041929 critical splice donor site probably null
R3161:Dlg4 UTSW 11 70017225 missense probably damaging 0.99
R4059:Dlg4 UTSW 11 70027083 missense probably benign
R4782:Dlg4 UTSW 11 70026954 missense probably damaging 1.00
R4910:Dlg4 UTSW 11 70030925 missense probably damaging 1.00
R5077:Dlg4 UTSW 11 70027026 missense possibly damaging 0.71
R5557:Dlg4 UTSW 11 70042280 missense probably damaging 1.00
R5996:Dlg4 UTSW 11 70017231 missense probably benign 0.00
R6649:Dlg4 UTSW 11 70023953 unclassified probably benign
R7155:Dlg4 UTSW 11 70017216 start codon destroyed probably null 0.00
R7284:Dlg4 UTSW 11 70042082 nonsense probably null
R7683:Dlg4 UTSW 11 70039854 missense possibly damaging 0.95
R7976:Dlg4 UTSW 11 70039182 missense probably damaging 0.99
R8051:Dlg4 UTSW 11 70031642 unclassified probably benign
R8408:Dlg4 UTSW 11 70042252 missense possibly damaging 0.81
R8431:Dlg4 UTSW 11 70039562 missense probably benign 0.36
Z1088:Dlg4 UTSW 11 70031130 missense probably damaging 1.00
Z1176:Dlg4 UTSW 11 70041920 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGTCATTATCTGTAGAGGGGTC -3'
(R):5'- ACAGCACTTGAAGCTCTTGAG -3'

Sequencing Primer
(F):5'- TCATTATCTGTAGAGGGGTCGAAAC -3'
(R):5'- CAGCACTTGAAGCTCTTGAGATTGAG -3'
Posted On2018-07-23