Incidental Mutation 'R6653:Heatr6'
ID526521
Institutional Source Beutler Lab
Gene Symbol Heatr6
Ensembl Gene ENSMUSG00000000976
Gene NameHEAT repeat containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83753696-83783754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83759365 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 216 (T216S)
Ref Sequence ENSEMBL: ENSMUSP00000001002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001002]
Predicted Effect probably benign
Transcript: ENSMUST00000001002
AA Change: T216S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000001002
Gene: ENSMUSG00000000976
AA Change: T216S

DomainStartEndE-ValueType
low complexity region 160 174 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
low complexity region 329 348 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Pfam:DUF4042 421 602 9.6e-73 PFAM
low complexity region 603 627 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 1078 1091 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127428
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Heatr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Heatr6 APN 11 83759309 missense probably damaging 1.00
IGL01681:Heatr6 APN 11 83765000 missense probably benign 0.08
IGL01905:Heatr6 APN 11 83781712 missense probably benign 0.06
IGL02037:Heatr6 APN 11 83764882 splice site probably benign
IGL02313:Heatr6 APN 11 83778892 missense probably damaging 1.00
IGL02652:Heatr6 APN 11 83769732 missense probably damaging 1.00
IGL03004:Heatr6 APN 11 83757379 missense probably benign 0.01
IGL03229:Heatr6 APN 11 83781445 missense probably benign 0.01
IGL03386:Heatr6 APN 11 83759377 missense probably damaging 1.00
IGL02802:Heatr6 UTSW 11 83760936 missense probably damaging 1.00
R0537:Heatr6 UTSW 11 83779464 nonsense probably null
R1658:Heatr6 UTSW 11 83758367 missense probably damaging 1.00
R1864:Heatr6 UTSW 11 83769230 missense probably damaging 0.97
R1893:Heatr6 UTSW 11 83757314 missense probably benign 0.33
R1944:Heatr6 UTSW 11 83769220 missense probably damaging 1.00
R2115:Heatr6 UTSW 11 83757455 unclassified probably benign
R3019:Heatr6 UTSW 11 83778832 splice site probably null
R4050:Heatr6 UTSW 11 83755773 missense probably damaging 0.99
R4532:Heatr6 UTSW 11 83769672 missense probably damaging 1.00
R4576:Heatr6 UTSW 11 83765000 missense probably benign 0.08
R4724:Heatr6 UTSW 11 83779548 nonsense probably null
R4825:Heatr6 UTSW 11 83758322 missense probably damaging 1.00
R5489:Heatr6 UTSW 11 83774432 missense probably damaging 1.00
R5970:Heatr6 UTSW 11 83753718 unclassified probably benign
R6136:Heatr6 UTSW 11 83772503 missense possibly damaging 0.94
R6145:Heatr6 UTSW 11 83766136 missense probably damaging 1.00
R6649:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6791:Heatr6 UTSW 11 83758341 missense probably benign
R6865:Heatr6 UTSW 11 83769140 missense probably damaging 1.00
R7154:Heatr6 UTSW 11 83777241 missense probably benign 0.05
R7385:Heatr6 UTSW 11 83759335 missense probably damaging 0.96
R7473:Heatr6 UTSW 11 83781391 missense probably damaging 1.00
R7959:Heatr6 UTSW 11 83781363 nonsense probably null
R8034:Heatr6 UTSW 11 83753909 missense probably benign 0.01
R8202:Heatr6 UTSW 11 83759408 missense possibly damaging 0.53
R8398:Heatr6 UTSW 11 83781338 missense probably benign 0.01
R8472:Heatr6 UTSW 11 83765853 missense probably benign 0.34
R8704:Heatr6 UTSW 11 83777278 missense probably benign 0.09
X0014:Heatr6 UTSW 11 83781250 missense probably damaging 0.97
Z1177:Heatr6 UTSW 11 83766081 missense probably benign 0.00
Z1177:Heatr6 UTSW 11 83781382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGTCATCCAAGAGTGCCG -3'
(R):5'- CACAGATCTGACTTCTGCCAC -3'

Sequencing Primer
(F):5'- CATCCAAGAGTGCCGTTTCTGG -3'
(R):5'- CTGACTTCTGCCACTGAATAGAG -3'
Posted On2018-07-23