Incidental Mutation 'R6653:Klhdc7b'
ID526529
Institutional Source Beutler Lab
Gene Symbol Klhdc7b
Ensembl Gene ENSMUSG00000091680
Gene Namekelch domain containing 7B
SynonymsEG546648
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89384917-89388867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89387089 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 725 (S725G)
Ref Sequence ENSEMBL: ENSMUSP00000153286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109314] [ENSMUST00000166926] [ENSMUST00000167959] [ENSMUST00000225666]
Predicted Effect probably benign
Transcript: ENSMUST00000109314
SMART Domains Protein: ENSMUSP00000104937
Gene: ENSMUSG00000078938

DomainStartEndE-ValueType
Pfam:Synaptonemal_3 1 86 4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166926
AA Change: S67G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130884
Gene: ENSMUSG00000091680
AA Change: S67G

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
Kelch 366 416 1.04e-6 SMART
Kelch 417 461 4.9e-3 SMART
Kelch 462 504 4.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167959
SMART Domains Protein: ENSMUSP00000131766
Gene: ENSMUSG00000078938

DomainStartEndE-ValueType
Pfam:Synaptonemal_3 1 85 6.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225666
AA Change: S725G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Klhdc7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Klhdc7b APN 15 89387369 missense probably benign 0.02
IGL02711:Klhdc7b APN 15 89388043 nonsense probably null
R0115:Klhdc7b UTSW 15 89388521 missense probably benign 0.05
R0718:Klhdc7b UTSW 15 89388169 missense possibly damaging 0.91
R0729:Klhdc7b UTSW 15 89387395 nonsense probably null
R0971:Klhdc7b UTSW 15 89387054 missense possibly damaging 0.79
R1794:Klhdc7b UTSW 15 89387020 missense probably benign 0.00
R1815:Klhdc7b UTSW 15 89387597 missense probably damaging 0.99
R1893:Klhdc7b UTSW 15 89387695 splice site probably null
R3508:Klhdc7b UTSW 15 89386892 start codon destroyed probably null 0.98
R3552:Klhdc7b UTSW 15 89387521 missense probably benign 0.02
R4001:Klhdc7b UTSW 15 89387984 missense probably damaging 1.00
R4618:Klhdc7b UTSW 15 89387269 missense probably benign 0.01
R4727:Klhdc7b UTSW 15 89387582 missense probably damaging 1.00
R5129:Klhdc7b UTSW 15 89388548 missense probably damaging 1.00
R5549:Klhdc7b UTSW 15 89387359 missense probably benign 0.01
R5643:Klhdc7b UTSW 15 89387659 missense possibly damaging 0.85
R5778:Klhdc7b UTSW 15 89387320 missense probably damaging 1.00
R5906:Klhdc7b UTSW 15 89387156 missense probably benign 0.02
R5942:Klhdc7b UTSW 15 89387431 missense probably benign 0.03
R6020:Klhdc7b UTSW 15 89388386 missense probably damaging 1.00
R6810:Klhdc7b UTSW 15 89388356 missense possibly damaging 0.61
R7399:Klhdc7b UTSW 15 89388644 missense possibly damaging 0.78
R7548:Klhdc7b UTSW 15 89388704 missense probably damaging 0.96
R7640:Klhdc7b UTSW 15 89387260 missense possibly damaging 0.61
R8461:Klhdc7b UTSW 15 89387621 missense probably damaging 0.97
R8712:Klhdc7b UTSW 15 89386822 missense probably benign 0.07
R8890:Klhdc7b UTSW 15 89388685 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGTTCTTAGAAGCCACCCC -3'
(R):5'- GAGCATCCTGCCTCATAGAAGTAG -3'

Sequencing Primer
(F):5'- CTTCCCCAGGCAAGAAAAGG -3'
(R):5'- CTGCCTCATAGAAGTAGGCGGTAC -3'
Posted On2018-07-23