Incidental Mutation 'R6653:Tmem44'
ID526531
Institutional Source Beutler Lab
Gene Symbol Tmem44
Ensembl Gene ENSMUSG00000022537
Gene Nametransmembrane protein 44
Synonyms9330161C17Rik, 1700007N03Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172614.3; Ensembl: ENSMUST00000140402

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location30511855-30550842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30537551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 110 (D110G)
Ref Sequence ENSEMBL: ENSMUSP00000116531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089775] [ENSMUST00000140402] [ENSMUST00000144001] [ENSMUST00000149110]
Predicted Effect probably benign
Transcript: ENSMUST00000089775
SMART Domains Protein: ENSMUSP00000087207
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125559
Predicted Effect possibly damaging
Transcript: ENSMUST00000140402
AA Change: D313G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123494
Gene: ENSMUSG00000022537
AA Change: D313G

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 179 197 N/A INTRINSIC
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144001
SMART Domains Protein: ENSMUSP00000119318
Gene: ENSMUSG00000022537

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144491
Predicted Effect probably damaging
Transcript: ENSMUST00000149110
AA Change: D110G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116531
Gene: ENSMUSG00000022537
AA Change: D110G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 44 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
low complexity region 180 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232166
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI

All alleles(8) : Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Tmem44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Tmem44 APN 16 30539381 splice site probably benign
IGL03308:Tmem44 APN 16 30543748 missense probably damaging 0.97
1mM(1):Tmem44 UTSW 16 30543497 unclassified probably benign
R0452:Tmem44 UTSW 16 30517463 splice site probably benign
R1073:Tmem44 UTSW 16 30514833 splice site probably benign
R1962:Tmem44 UTSW 16 30543401 critical splice donor site probably null
R2118:Tmem44 UTSW 16 30547444 nonsense probably null
R2122:Tmem44 UTSW 16 30547444 nonsense probably null
R2124:Tmem44 UTSW 16 30547444 nonsense probably null
R4870:Tmem44 UTSW 16 30540773 missense probably damaging 1.00
R5328:Tmem44 UTSW 16 30540891 missense possibly damaging 0.83
R6818:Tmem44 UTSW 16 30543221 splice site probably null
R7058:Tmem44 UTSW 16 30547395 missense possibly damaging 0.92
R7738:Tmem44 UTSW 16 30543410 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GAACCATCTCTTTCAGGAAGCC -3'
(R):5'- TCTGAGCATGGGAAGACCTCTG -3'

Sequencing Primer
(F):5'- CTGCCAGGCTTTCTTCTCAC -3'
(R):5'- AGGCAGGGTCTCACTGTATATCC -3'
Posted On2018-07-23