Incidental Mutation 'R6653:Vmn2r112'
ID 526534
Institutional Source Beutler Lab
Gene Symbol Vmn2r112
Ensembl Gene ENSMUSG00000094921
Gene Name vomeronasal 2, receptor 112
Synonyms EG628185
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R6653 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22601148-22619133 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22601179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 11 (L11Q)
Ref Sequence ENSEMBL: ENSMUSP00000094994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097381]
AlphaFold L7N221
Predicted Effect probably null
Transcript: ENSMUST00000097381
AA Change: L11Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: L11Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.8e-32 PFAM
Pfam:NCD3G 512 565 5.8e-21 PFAM
Pfam:7tm_3 598 833 6.5e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Vmn2r112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Vmn2r112 APN 17 22618936 missense probably benign 0.13
IGL01021:Vmn2r112 APN 17 22618904 missense probably damaging 1.00
IGL01122:Vmn2r112 APN 17 22603007 missense probably benign 0.00
IGL01360:Vmn2r112 APN 17 22618622 missense probably benign 0.03
IGL01536:Vmn2r112 APN 17 22605155 missense probably damaging 1.00
IGL02148:Vmn2r112 APN 17 22619032 missense probably damaging 1.00
IGL02465:Vmn2r112 APN 17 22614994 missense probably damaging 1.00
PIT4576001:Vmn2r112 UTSW 17 22614931 missense probably benign 0.00
R0278:Vmn2r112 UTSW 17 22603006 missense probably benign 0.44
R0328:Vmn2r112 UTSW 17 22605270 missense probably benign 0.01
R0583:Vmn2r112 UTSW 17 22618949 missense probably damaging 1.00
R0831:Vmn2r112 UTSW 17 22614999 missense probably damaging 0.99
R1080:Vmn2r112 UTSW 17 22618999 missense probably damaging 1.00
R1245:Vmn2r112 UTSW 17 22603247 missense probably benign 0.03
R1321:Vmn2r112 UTSW 17 22618519 nonsense probably null
R1381:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R1514:Vmn2r112 UTSW 17 22602844 missense probably benign 0.40
R1519:Vmn2r112 UTSW 17 22618903 missense possibly damaging 0.83
R1572:Vmn2r112 UTSW 17 22603144 missense possibly damaging 0.61
R1590:Vmn2r112 UTSW 17 22615008 critical splice donor site probably null
R1640:Vmn2r112 UTSW 17 22605116 missense probably benign 0.01
R2221:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2223:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2310:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2312:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2337:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2339:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2340:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2341:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2342:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2401:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2860:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2861:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2926:Vmn2r112 UTSW 17 22615003 missense possibly damaging 0.90
R3236:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3237:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3977:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3979:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R4168:Vmn2r112 UTSW 17 22603088 missense probably benign 0.01
R4256:Vmn2r112 UTSW 17 22618412 missense probably damaging 1.00
R4386:Vmn2r112 UTSW 17 22601322 missense probably benign 0.36
R4912:Vmn2r112 UTSW 17 22603382 missense probably damaging 0.99
R4947:Vmn2r112 UTSW 17 22602879 missense probably benign 0.02
R5446:Vmn2r112 UTSW 17 22618250 missense probably damaging 1.00
R5870:Vmn2r112 UTSW 17 22619023 missense probably benign 0.00
R6351:Vmn2r112 UTSW 17 22601278 missense probably benign
R6384:Vmn2r112 UTSW 17 22605155 missense probably damaging 1.00
R6390:Vmn2r112 UTSW 17 22605249 missense probably benign 0.01
R6401:Vmn2r112 UTSW 17 22603551 nonsense probably null
R6405:Vmn2r112 UTSW 17 22618235 missense probably damaging 1.00
R6620:Vmn2r112 UTSW 17 22603101 missense probably benign 0.00
R6648:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R6649:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6654:Vmn2r112 UTSW 17 22603469 missense possibly damaging 0.89
R6700:Vmn2r112 UTSW 17 22603481 missense possibly damaging 0.53
R6993:Vmn2r112 UTSW 17 22603214 missense probably benign 0.01
R7052:Vmn2r112 UTSW 17 22602526 missense probably benign
R7454:Vmn2r112 UTSW 17 22603307 missense probably benign 0.00
R7763:Vmn2r112 UTSW 17 22603118 missense probably damaging 1.00
R8032:Vmn2r112 UTSW 17 22603394 missense probably benign 0.21
R8177:Vmn2r112 UTSW 17 22603613 missense possibly damaging 0.47
R8263:Vmn2r112 UTSW 17 22605159 missense probably damaging 1.00
R8395:Vmn2r112 UTSW 17 22618606 missense possibly damaging 0.94
R8492:Vmn2r112 UTSW 17 22602489 missense probably benign 0.03
R8889:Vmn2r112 UTSW 17 22618631 missense probably damaging 1.00
R8892:Vmn2r112 UTSW 17 22618631 missense probably damaging 1.00
R9246:Vmn2r112 UTSW 17 22605107 missense probably benign 0.21
R9269:Vmn2r112 UTSW 17 22601232 missense probably benign
R9273:Vmn2r112 UTSW 17 22618740 missense probably damaging 1.00
R9288:Vmn2r112 UTSW 17 22603342 missense probably damaging 1.00
R9352:Vmn2r112 UTSW 17 22603498 missense probably damaging 0.98
R9406:Vmn2r112 UTSW 17 22605242 nonsense probably null
R9432:Vmn2r112 UTSW 17 22602252 missense
Z1088:Vmn2r112 UTSW 17 22605078 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATGATTCCTCCAGGGGTGAG -3'
(R):5'- CTTGGGAAACATTCATGATGACTG -3'

Sequencing Primer
(F):5'- TTCCTCCAGGGGTGAGGAAAC -3'
(R):5'- CATGATGACTGTACATGGAAAACAC -3'
Posted On 2018-07-23